diff --git a/lib/std/core/builtin.c3 b/lib/std/core/builtin.c3
index f7179051e..d1e60fe8e 100644
--- a/lib/std/core/builtin.c3
+++ b/lib/std/core/builtin.c3
@@ -56,12 +56,12 @@ macro varcast(variant v, $Type) @builtin
 struct CallstackElement
 {
 	CallstackElement* prev;
-	char[] function;
-	char[] file;
+	String function;
+	String file;
 	uint line;
 }
 
-fn void default_panic(char[] message, char[] file, char[] function, uint line)
+fn void default_panic(String message, String file, String function, uint line)
 {
 	CallstackElement* stack = $$stacktrace();
 	$if ($defined(libc::stderr) && $defined(libc::fprintf)):
@@ -88,7 +88,7 @@ fn void default_panic(char[] message, char[] file, char[] function, uint line)
 	$$trap();
 }
 
-define PanicFn = fn void(char[] message, char[] file, char[] function, uint line);
+define PanicFn = fn void(String message, String file, String function, uint line);
 
 PanicFn panic = &default_panic;
 
@@ -110,7 +110,7 @@ macro bitcast(expr, $Type) @builtin
 /**
  * @require $Type.kindof == TypeKind.ENUM `Only enums may be used`
  **/
-macro enum_by_name($Type, char[] enum_name) @builtin
+macro enum_by_name($Type, String enum_name) @builtin
 {
 	typeid x = $Type.typeid;
 	foreach (i, name : x.names)
@@ -164,4 +164,4 @@ macro uint long.hash(long i) = (uint)((i >> 32) ^ i);
 macro uint ulong.hash(ulong i) = (uint)((i >> 32) ^ i);
 macro uint bool.hash(bool b) = (uint)b;
 macro uint typeid.hash(typeid t) = (uint)(((uptr)t >> 32) ^ (uptr)t);
-macro uint char[].hash(char[] c) = (uint)fnv32a::encode(c);
\ No newline at end of file
+macro uint String.hash(String c) = (uint)fnv32a::encode(c);
\ No newline at end of file
diff --git a/lib/std/core/conv.c3 b/lib/std/core/conv.c3
index 625334674..1612a553b 100644
--- a/lib/std/core/conv.c3
+++ b/lib/std/core/conv.c3
@@ -185,7 +185,7 @@ fn Char32! utf8_to_char32(char* ptr, usz* size)
  * @param utf8 `An UTF-8 encoded slice of bytes`
  * @return `the number of encoded code points`
  **/
-fn usz utf8_codepoints(char[] utf8)
+fn usz utf8_codepoints(String utf8)
 {
 	usz len = 0;
 	foreach (char c : utf8)
@@ -257,7 +257,7 @@ fn usz utf8len_for_utf16(Char16[] utf16)
  * @param utf8 `the utf8 data to calculate from`
  * @return `the length of the resulting UTF16 array`
  **/
-fn usz utf16len_for_utf8(char[] utf8)
+fn usz utf16len_for_utf8(String utf8)
 {
 	usz len = utf8.len;
 	usz len16 = 0;
@@ -297,7 +297,7 @@ fn usz utf16len_for_utf32(Char32[] utf32)
  * @param [out] utf8_buffer
  * @return `the number of bytes written.`
  **/
-fn usz! utf32to8(Char32[] utf32, char[] utf8_buffer)
+fn usz! utf32to8(Char32[] utf32, String utf8_buffer)
 {
 	usz len = utf8_buffer.len;
 	char* ptr = utf8_buffer.ptr;
@@ -317,7 +317,7 @@ fn usz! utf32to8(Char32[] utf32, char[] utf8_buffer)
  * @param [out] utf32_buffer
  * @return `the number of Char32s written.`
  **/
-fn usz! utf8to32(char[] utf8, Char32[] utf32_buffer)
+fn usz! utf8to32(String utf8, Char32[] utf32_buffer)
 {
 	usz len = utf8.len;
 	Char32* ptr = utf32_buffer.ptr;
@@ -361,7 +361,7 @@ fn void! utf16to8_unsafe(Char16[] utf16, char* utf8_buffer)
  * @param [in] utf8 `The UTF8 buffer containing the data to convert.`
  * @param [out] utf32_buffer `the (sufficiently large) buffer to hold the UTF8 data.`
  **/
-fn void! utf8to32_unsafe(char[] utf8, Char32* utf32_buffer)
+fn void! utf8to32_unsafe(String utf8, Char32* utf32_buffer)
 {
 	usz len = utf8.len;
 	for (usz i = 0; i < len;)
@@ -381,7 +381,7 @@ fn void! utf8to32_unsafe(char[] utf8, Char32* utf32_buffer)
  * @param [in] utf8 `The UTF8 buffer containing the data to convert.`
  * @param [out] utf16_buffer `the (sufficiently large) buffer to hold the UTF8 data.`
  **/
-fn void! utf8to16_unsafe(char[] utf8, Char16* utf16_buffer)
+fn void! utf8to16_unsafe(String utf8, Char16* utf16_buffer)
 {
 	usz len = utf8.len;
     for (usz i = 0; i < len;)
diff --git a/lib/std/core/str.c3 b/lib/std/core/str.c3
index b34e0c9a6..6f20581a6 100644
--- a/lib/std/core/str.c3
+++ b/lib/std/core/str.c3
@@ -1,5 +1,7 @@
 module std::core::str;
+
 define ZString = distinct char*;
+define String = char[];
 define Char32 = uint;
 define Char16 = ushort;
 
@@ -18,17 +20,17 @@ fault NumberConversion
 	MALFORMED_INTEGER,
 	INTEGER_OVERFLOW,
 }
-fn String join(char[][] s, char[] joiner)
+fn VarString join(String[] s, String joiner)
 {
-	if (!s.len) return (String)null;
+	if (!s.len) return (VarString)null;
 	usz total_size = joiner.len * s.len;
-	foreach (char[]* &str : s)
+	foreach (String* &str : s)
 	{
 		total_size += str.len;
 	}
-	String res = string::new_with_capacity(total_size);
+	VarString res = string::new_with_capacity(total_size);
 	res.append(s[0]);
-	foreach (char[]* &str : s[1..])
+	foreach (String* &str : s[1..])
 	{
 		res.append(joiner);
 		res.append(*str);
@@ -36,7 +38,7 @@ fn String join(char[][] s, char[] joiner)
 	return res;
 }
 
-macro bool char_in_set(char c, char[] set)
+macro bool char_in_set(char c, String set)
 {
 	foreach (ch : set)
 	{
@@ -50,7 +52,7 @@ private macro char_is_space_tab(char c)
 	return c == ' ' || c == '\t';
 }
 
-private macro to_integer($Type, char[] string)
+private macro to_integer($Type, String string)
 {
 	usz len = string.len;
 	usz index = 0;
@@ -121,19 +123,19 @@ private macro to_integer($Type, char[] string)
 	return value;
 }
 
-fn int128! to_int128(char[] string) = to_integer(int128, string);
-fn long! to_long(char[] string) = to_integer(long, string);
-fn int! to_int(char[] string) = to_integer(int, string);
-fn short! to_short(char[] string) = to_integer(short, string);
-fn ichar! to_ichar(char[] string) = to_integer(ichar, string);
+fn int128! to_int128(String string) = to_integer(int128, string);
+fn long! to_long(String string) = to_integer(long, string);
+fn int! to_int(String string) = to_integer(int, string);
+fn short! to_short(String string) = to_integer(short, string);
+fn ichar! to_ichar(String string) = to_integer(ichar, string);
 
-fn uint128! to_uint128(char[] str) = to_integer(uint128, str);
-fn ulong! to_ulong(char[] str) = to_integer(ulong, str);
-fn uint! to_uint(char[] str) = to_integer(uint, str);
-fn ushort! to_ushort(char[] str) = to_integer(ushort, str);
-fn char! to_uchar(char[] str) = to_integer(char, str);
+fn uint128! to_uint128(String str) = to_integer(uint128, str);
+fn ulong! to_ulong(String str) = to_integer(ulong, str);
+fn uint! to_uint(String str) = to_integer(uint, str);
+fn ushort! to_ushort(String str) = to_integer(ushort, str);
+fn char! to_uchar(String str) = to_integer(char, str);
 
-fn char[] trim(char[] string, char[] to_trim = "\t\n\r ")
+fn String trim(String string, String to_trim = "\t\n\r ")
 {
 	usz start = 0;
 	usz len = string.len;
@@ -144,7 +146,7 @@ fn char[] trim(char[] string, char[] to_trim = "\t\n\r ")
 	return string[start..end];
 }
 
-fn bool starts_with(char[] s, char[] needle)
+fn bool starts_with(String s, String needle)
 {
 	if (needle.len > s.len) return false;
 	foreach (i, c : needle)
@@ -154,17 +156,17 @@ fn bool starts_with(char[] s, char[] needle)
 	return true;
 }
 
-fn char[][] tsplit(char[] s, char[] needle) = split(s, needle, mem::temp_allocator()) @inline;
+fn String[] tsplit(String s, String needle) = split(s, needle, mem::temp_allocator()) @inline;
 
-fn char[][] split(char[] s, char[] needle, Allocator* allocator = mem::current_allocator())
+fn String[] split(String s, String needle, Allocator* allocator = mem::current_allocator())
 {
 	usz capacity = 16;
 	usz i = 0;
-	char[]* holder = allocator.alloc(char[].sizeof * capacity)!!;
+	String* holder = allocator.alloc(String.sizeof * capacity)!!;
 	while (s.len)
 	{
 		usz! index = index_of(s, needle);
-		char[] res = void;
+		String res = void;
 		if (try index)
 		{
 			res = s[:index];
@@ -178,14 +180,14 @@ fn char[][] split(char[] s, char[] needle, Allocator* allocator = mem::current_a
 		if (i == capacity)
 		{
 			capacity *= 2;
-			holder = allocator.realloc(holder, char[].sizeof * capacity)!!;
+			holder = allocator.realloc(holder, String.sizeof * capacity)!!;
 		}
 		holder[i++] = res;
 	}
 	return holder[:i];
 }
 
-fn usz! rindex_of(char[] s, char[] needle)
+fn usz! rindex_of(String s, String needle)
 {
 	usz match = 0;
 	usz needed = needle.len;
@@ -211,7 +213,7 @@ fn usz! rindex_of(char[] s, char[] needle)
 	return SearchResult.MISSING!;
 }
 
-fn usz! index_of(char[] s, char[] needle)
+fn usz! index_of(String s, String needle)
 {
 	usz match = 0;
 	usz needed = needle.len;
@@ -237,7 +239,7 @@ fn usz! index_of(char[] s, char[] needle)
 	return SearchResult.MISSING!;
 }
 
-fn ZString copy_zstring(char[] s, Allocator* allocator = mem::current_allocator())
+fn ZString copy_zstring(String s, Allocator* allocator = mem::current_allocator())
 {
     usz len = s.len;
     char* str = allocator.alloc(len + 1)!!;
@@ -246,7 +248,7 @@ fn ZString copy_zstring(char[] s, Allocator* allocator = mem::current_allocator(
     return (ZString)str;
 }
 
-fn char[] copyz(char[] s, Allocator* allocator = mem::current_allocator())
+fn String copyz(String s, Allocator* allocator = mem::current_allocator())
 {
     usz len = s.len;
     char* str = allocator.alloc(len + 1)!!;
@@ -255,12 +257,12 @@ fn char[] copyz(char[] s, Allocator* allocator = mem::current_allocator())
     return str[:len];
 }
 
-fn ZString tcopy_zstring(char[] s)
+fn ZString tcopy_zstring(String s)
 {
 	return copy_zstring(s, mem::temp_allocator());
 }
 
-fn bool compare(char[] a, char[] b)
+fn bool compare(String a, String b)
 {
 	if (a.len != b.len) return false;
 	foreach (i, c : a)
@@ -276,7 +278,7 @@ fault UnicodeResult
 	CONVERSION_FAILED,
 }
 
-fn usz utf8_codepoints(char[] utf8)
+fn usz utf8_codepoints(String utf8)
 {
 	usz len = 0;
 	foreach (char c : utf8)
@@ -286,7 +288,7 @@ fn usz utf8_codepoints(char[] utf8)
 	return len;
 }
 
-fn Char32[]! utf8to32(char[] utf8, Allocator* allocator = mem::current_allocator)
+fn Char32[]! utf8to32(String utf8, Allocator* allocator = mem::current_allocator)
 {
 	usz codepoints = conv::utf8_codepoints(utf8);
 	Char32* data = allocator.alloc(Char32.sizeof * (codepoints + 1))?;
@@ -295,7 +297,7 @@ fn Char32[]! utf8to32(char[] utf8, Allocator* allocator = mem::current_allocator
 	return data[:codepoints];
 }
 
-fn char[] utf32to8(Char32[] utf32, Allocator* allocator = mem::current_allocator)
+fn String utf32to8(Char32[] utf32, Allocator* allocator = mem::current_allocator)
 {
 	usz len = conv::utf8len_for_utf32(utf32);
 	char* data = allocator.alloc(len + 1)!!;
@@ -304,7 +306,7 @@ fn char[] utf32to8(Char32[] utf32, Allocator* allocator = mem::current_allocator
 	return data[:len];
 }
 
-fn Char16[]! utf8to16(char[] utf8, Allocator* allocator = mem::current_allocator)
+fn Char16[]! utf8to16(String utf8, Allocator* allocator = mem::current_allocator)
 {
 	usz len16 = conv::utf16len_for_utf8(utf8);
 	Char16* data = allocator.alloc((len16 + 1) * Char16.sizeof)?;
@@ -314,7 +316,7 @@ fn Char16[]! utf8to16(char[] utf8, Allocator* allocator = mem::current_allocator
 }
 
 
-fn char[]! utf16to8(Char16[] utf16, Allocator* allocator = mem::current_allocator())
+fn String! utf16to8(Char16[] utf16, Allocator* allocator = mem::current_allocator())
 {
 	usz len = conv::utf8len_for_utf16(utf16);
 	char* data = allocator.alloc(len + 1)?;
@@ -322,21 +324,21 @@ fn char[]! utf16to8(Char16[] utf16, Allocator* allocator = mem::current_allocato
 	return data[:len];
 }
 
-fn char[] copy(char[] s, Allocator* allocator = mem::current_allocator())
+fn String copy(String s, Allocator* allocator = mem::current_allocator())
 {
     usz len = s.len;
     ZString str_copy = copy_zstring(s, allocator) @inline;
     return str_copy[:len];
 }
 
-fn char[] tcopy(char[] s)
+fn String tcopy(String s)
 {
     usz len = s.len;
     ZString str_copy = tcopy_zstring(s) @inline;
     return str_copy[:len];
 }
 
-fn char[] tconcat(char[] s1, char[] s2)
+fn String tconcat(String s1, String s2)
 {
     usz full_len = s1.len + s2.len;
     char* str = tmalloc(full_len + 1);
@@ -347,7 +349,7 @@ fn char[] tconcat(char[] s1, char[] s2)
     return str[:full_len];
 }
 
-fn char[] concat(char[] s1, char[] s2)
+fn String concat(String s1, String s2)
 {
     usz full_len = s1.len + s2.len;
     char* str = malloc(full_len + 1);
@@ -358,7 +360,7 @@ fn char[] concat(char[] s1, char[] s2)
     return str[:full_len];
 }
 
-fn char[] ZString.as_str(ZString str)
+fn String ZString.as_str(ZString str)
 {
 	return ((char*)str)[:str.len()];
 }
diff --git a/lib/std/core/string.c3 b/lib/std/core/string.c3
index 060c8b64d..6c30199fb 100644
--- a/lib/std/core/string.c3
+++ b/lib/std/core/string.c3
@@ -1,7 +1,7 @@
 module std::core::string;
 import libc;
 
-define String = distinct void*;
+define VarString = distinct void*;
 
 private struct StringData
 {
@@ -13,30 +13,30 @@ private struct StringData
 
 const usz MIN_CAPACITY = 16;
 
-fn String new_with_capacity(usz capacity, Allocator* allocator = mem::current_allocator())
+fn VarString new_with_capacity(usz capacity, Allocator* allocator = mem::current_allocator())
 {
 	if (capacity < MIN_CAPACITY) capacity = MIN_CAPACITY;
 	StringData* data = allocator.alloc(StringData.sizeof + capacity)!!;
 	data.allocator = allocator;
 	data.len = 0;
 	data.capacity = capacity;
-	return (String)data;
+	return (VarString)data;
 }
 
-fn String new(char[] c)
+fn VarString new(String c)
 {
 	usz len = c.len;
-	String str = new_with_capacity(len);
+	VarString str = new_with_capacity(len);
 	StringData* data = str.data();
 	if (len)
 	{
 		data.len = len;
 		mem::copy(&data.chars, c.ptr, len);
 	}
-	return (String)data;
+	return (VarString)data;
 }
 
-fn ZString String.zstr(String str)
+fn ZString VarString.zstr(VarString str)
 {
 	StringData* data = str.data();
 	if (!data) return (ZString)"";
@@ -52,7 +52,7 @@ fn ZString String.zstr(String str)
 	return (ZString)&data.chars[0];
 }
 
-fn usz String.len(String this)
+fn usz VarString.len(VarString this)
 {
 	if (!this) return 0;
 	return this.data().len;
@@ -61,20 +61,20 @@ fn usz String.len(String this)
 /**
  * @require new_size <= this.len()
  */
-fn void String.chop(String this, usz new_size)
+fn void VarString.chop(VarString this, usz new_size)
 {
 	if (!this) return;
 	this.data().len = new_size;
 }
 
-fn char[] String.str(String str)
+fn String VarString.str(VarString str)
 {
 	StringData* data = (StringData*)str;
-	if (!data) return char[] {};
-	return data.chars[:data.len];
+	if (!data) return String {};
+	return (String)data.chars[:data.len];
 }
 
-fn void String.append_utf32(String* str, Char32[] chars)
+fn void VarString.append_utf32(VarString* str, Char32[] chars)
 {
 	str.reserve(chars.len);
 	foreach (Char32 c : chars)
@@ -86,12 +86,12 @@ fn void String.append_utf32(String* str, Char32[] chars)
 /**
  * @require index < str.len()
  **/
-fn void String.set(String str, usz index, char c)
+fn void VarString.set(VarString str, usz index, char c)
 {
 	str.data().chars[index] = c;
 }
 
-fn void String.append_repeat(String* str, char c, usz times)
+fn void VarString.append_repeat(VarString* str, char c, usz times)
 {
 	if (times == 0) return;
 	str.reserve(times);
@@ -105,7 +105,7 @@ fn void String.append_repeat(String* str, char c, usz times)
 /**
  * @require c < 0x10ffff
  */
-fn void String.append_char32(String* str, Char32 c)
+fn void VarString.append_char32(VarString* str, Char32 c)
 {
 	if (c < 0x7f)
 	{
@@ -139,23 +139,23 @@ fn void String.append_char32(String* str, Char32 c)
     data.chars[data.len++] = (char)(0x80 | (c & 0x3F));
 }
 
-fn String String.tcopy(String* str) = str.copy(mem::temp_allocator());
+fn VarString VarString.tcopy(VarString* str) = str.copy(mem::temp_allocator());
 
-fn String String.copy(String* str, Allocator* allocator = null)
+fn VarString VarString.copy(VarString* str, Allocator* allocator = null)
 {
 	if (!str)
 	{
 		if (allocator) return new_with_capacity(0, allocator);
-		return (String)null;
+		return (VarString)null;
 	}
 	if (!allocator) allocator = mem::current_allocator();
 	StringData* data = str.data();
-	String new_string = new_with_capacity(data.capacity, allocator);
+	VarString new_string = new_with_capacity(data.capacity, allocator);
 	mem::copy((char*)new_string.data(), (char*)data, StringData.sizeof + data.len);
 	return new_string;
 }
 
-fn ZString String.copy_zstr(String* str, Allocator* allocator = mem::current_allocator())
+fn ZString VarString.copy_zstr(VarString* str, Allocator* allocator = mem::current_allocator())
 {
 	usz str_len = str.len();
 	if (!str_len)
@@ -169,14 +169,14 @@ fn ZString String.copy_zstr(String* str, Allocator* allocator = mem::current_all
 	return (ZString)zstr;
 }
 
-fn char[] String.copy_str(String* str, Allocator* allocator = mem::current_allocator())
+fn String VarString.copy_str(VarString* str, Allocator* allocator = mem::current_allocator())
 {
-	return str.copy_zstr(allocator)[:str.len()];
+	return (String)str.copy_zstr(allocator)[:str.len()];
 }
 
-fn char[] String.tcopy_str(String* str) = str.copy_str(mem::temp_allocator()) @inline;
+fn String VarString.tcopy_str(VarString* str) = str.copy_str(mem::temp_allocator()) @inline;
 
-fn bool String.equals(String str, String other_string)
+fn bool VarString.equals(VarString str, VarString other_string)
 {
 	StringData *str1 = str.data();
 	StringData *str2 = other_string.data();
@@ -192,16 +192,16 @@ fn bool String.equals(String str, String other_string)
 	return true;
 }
 
-fn void String.destroy(String* str)
+fn void VarString.destroy(VarString* str)
 {
 	if (!*str) return;
 	StringData* data = str.data();
 	if (!data) return;
 	data.allocator.free(data)!!;
-	*str = (String)null;
+	*str = (VarString)null;
 }
 
-fn bool String.less(String str, String other_string)
+fn bool VarString.less(VarString str, VarString other_string)
 {
 	StringData* str1 = str.data();
 	StringData* str2 = other_string.data();
@@ -218,7 +218,7 @@ fn bool String.less(String str, String other_string)
 	return true;
 }
 
-fn void String.append_chars(String* this, char[] str)
+fn void VarString.append_chars(VarString* this, String str)
 {
 	usz other_len = str.len;
 	if (!other_len) return;
@@ -233,19 +233,19 @@ fn void String.append_chars(String* this, char[] str)
 	data.len += other_len;
 }
 
-fn Char32[] String.copy_utf32(String* this, Allocator* allocator = mem::current_allocator())
+fn Char32[] VarString.copy_utf32(VarString* this, Allocator* allocator = mem::current_allocator())
 {
 	return str::utf8to32(this.str(), allocator) @inline!!;
 }
 
-fn void String.append_string(String* this, String str)
+fn void VarString.append_string(VarString* this, VarString str)
 {
 	StringData* other = (StringData*)str;
 	if (!other) return;
 	this.append(str.str());
 }
 
-fn void String.append_char(String* str, char c)
+fn void VarString.append_char(VarString* str, char c)
 {
 	if (!*str)
 	{
@@ -257,23 +257,23 @@ fn void String.append_char(String* str, char c)
 }
 
 
-macro void String.append(String* str, value)
+macro void VarString.append(VarString* str, value)
 {
 	var $Type = $typeof(value);
 	$switch ($Type):
 		$case char:
 		$case ichar:
 			str.append_char(value);
-		$case String:
+		$case VarString:
 			str.append_string(value);
-		$case char[]:
+		$case String:
 			str.append_chars(value);
 		$case Char32:
 			str.append_char32(value);
 		$default:
 			$if (@convertible($Type, Char32)):
 				str.append_char32(value);
-			$elif (@convertible($Type, char[])):
+			$elif (@convertible($Type, String)):
 				str.append_chars(value);
 			$else:
 				$assert("Unsupported type for appending");
@@ -282,12 +282,12 @@ macro void String.append(String* str, value)
 }
 
 
-private fn StringData* String.data(String str) @inline
+private fn StringData* VarString.data(VarString str) @inline
 {
 	return (StringData*)str;
 }
 
-private fn void String.reserve(String* str, usz addition)
+private fn void VarString.reserve(VarString* str, usz addition)
 {
 	StringData* data = str.data();
 	if (!data)
@@ -299,12 +299,12 @@ private fn void String.reserve(String* str, usz addition)
 	if (data.capacity >= len) return;
 	usz new_capacity = data.capacity *= 2;
 	if (new_capacity < MIN_CAPACITY) new_capacity = MIN_CAPACITY;
-	*str = (String)data.allocator.realloc(data, StringData.sizeof + new_capacity)!!;
+	*str = (VarString)data.allocator.realloc(data, StringData.sizeof + new_capacity)!!;
 }
 
-fn String String.new_concat(String a, String b, Allocator* allocator = mem::current_allocator())
+fn VarString VarString.new_concat(VarString a, VarString b, Allocator* allocator = mem::current_allocator())
 {
-	String string = new_with_capacity(a.len() + b.len(), allocator);
+	VarString string = new_with_capacity(a.len() + b.len(), allocator);
 	string.append(a);
 	string.append(b);
 	return string; 
diff --git a/lib/std/core/string_iterator.c3 b/lib/std/core/string_iterator.c3
index 51a9e662c..f2df2ac42 100644
--- a/lib/std/core/string_iterator.c3
+++ b/lib/std/core/string_iterator.c3
@@ -2,7 +2,7 @@ module std::core::string::iterator;
 
 struct StringIterator
 {
-	char[] utf8;
+	String utf8;
 	usz current;
 }
 
diff --git a/lib/std/io/dir.c3 b/lib/std/io/dir.c3
index c75fb0a94..b3a9f1dfa 100644
--- a/lib/std/io/dir.c3
+++ b/lib/std/io/dir.c3
@@ -1,7 +1,7 @@
 module std::io::dir;
 import std::io::os;
 // In progress.
-define Path = distinct char[];
+define Path = distinct String;
 
 const PREFERRED_SEPARATOR = USE_WIN32_FILESYSTEM ? '\\' : '/';
 private const USE_WIN32_FILESYSTEM = env::OS_TYPE != OsType.WIN32;
@@ -11,12 +11,12 @@ fault PathResult
 	INVALID_PATH
 }
 
-fn char[]! getcwd(Allocator* allocator = mem::default_allocator())
+fn String! getcwd(Allocator* allocator = mem::default_allocator())
 {
 	return os::getcwd(allocator);
 }
 
-fn char[]! tgetcwd()
+fn String! tgetcwd()
 {
 	return getcwd(mem::temp_allocator()) @inline;
 }
@@ -56,7 +56,7 @@ $else:
 $endif;
 }
 
-private fn usz! root_name_len(char[] path)
+private fn usz! root_name_len(String path)
 {
 	usz len = path.len;
 	if (!len) return 0;
@@ -83,9 +83,9 @@ private fn usz! root_name_len(char[] path)
 	return 0;
 }
 
-private fn void! normalize_path(char[]* path_ref)
+private fn void! normalize_path(String* path_ref)
 {
-	char[] path = *path_ref;
+	String path = *path_ref;
 	if (!path.len) return;
     usz path_start = root_name_len(path)?;
 	usz len = path_start;
@@ -137,16 +137,16 @@ private fn void! normalize_path(char[]* path_ref)
 	*path_ref = path[:len];
 }
 
-fn Path new_path(char[] path)
+fn Path new_path(String path)
 {
-	char[] copy = str::copy(path);
+	String copy = str::copy(path);
 	normalize_path(&copy)!!;
 	return (Path)copy;
 }
 
 fn Path Path.root_name(Path path)
 {
-	char[] path_str = (char[])path;
+	String path_str = (String)path;
 	usz len = root_name_len(path_str)!!;
 	if (!len) return (Path)"";
 	return (Path)path_str[0:len];
@@ -154,7 +154,7 @@ fn Path Path.root_name(Path path)
 
 fn Path Path.root_directory(Path path)
 {
-	char[] path_str = (char[])path;
+	String path_str = (String)path;
 	usz len = path_str.len;
 	if (!len) return (Path)"";
 	$if (USE_WIN32_FILESYSTEM):
diff --git a/lib/std/io/io_file.c3 b/lib/std/io/io_file.c3
index 0390404e1..a2141e5fe 100644
--- a/lib/std/io/io_file.c3
+++ b/lib/std/io/io_file.c3
@@ -1,7 +1,7 @@
 module std::io;
 import libc;
 
-fn void! File.open(File* file, char[] filename, char[] mode)
+fn void! File.open(File* file, String filename, String mode)
 {
 	@pool()
 	{
@@ -102,7 +102,7 @@ fn usz File.write(File* file, void* buffer, usz items, usz element_size = 1)
  * @param [&in] file
  * @require file.file `File must be initialized`
  */
-fn usz! File.println(File* file, char[] string)
+fn usz! File.println(File* file, String string)
 {
     usz len = string.len;
     if (len != libc::fwrite(string.ptr, 1, len, file.file)) return IoError.UNKNOWN_ERROR!;
@@ -114,9 +114,9 @@ fn usz! File.println(File* file, char[] string)
  * @param [&in] file
  * @require file.file `File must be initialized`
  */
-fn String File.getline(File* file, Allocator* allocator = mem::current_allocator())
+fn VarString File.getline(File* file, Allocator* allocator = mem::current_allocator())
 {
-	String s = string::new_with_capacity(120, allocator);
+	VarString s = string::new_with_capacity(120, allocator);
 	while (!file.eof())
 	{
 		int c = libc::fgetc(file.file);
@@ -130,12 +130,12 @@ fn String File.getline(File* file, Allocator* allocator = mem::current_allocator
 /**
  * @param [&in] file
  * @require file.file `File must be initialized`
- * @return "a zero terminated char[] (the pointer may be safely cast into a ZString)"
+ * @return "a zero terminated String (the pointer may be safely cast into a ZString)"
  */
-fn char[] File.tgetline(File* file)
+fn String File.tgetline(File* file)
 {
 
-	String s = file.getline(mem::temp_allocator());
+	VarString s = file.getline(mem::temp_allocator());
 	ZString z = s.zstr();
 	return z[:s.len()];
 }
diff --git a/lib/std/io/io_fileinfo.c3 b/lib/std/io/io_fileinfo.c3
index 644eeaf7a..7bfcca28e 100644
--- a/lib/std/io/io_fileinfo.c3
+++ b/lib/std/io/io_fileinfo.c3
@@ -43,7 +43,7 @@ fn void! FileInfo.read(FileInfo* info, Path path)
 	@pool()
 	{
 		Darwin64Stat stat;
-		int res = _stat(str::tcopy_zstring((char[])path), &stat);
+		int res = _stat(str::tcopy_zstring((String)path), &stat);
 		if (res != 0)
 		{
 			switch (libc::errno())
diff --git a/lib/std/io/io_formatter_private.c3 b/lib/std/io/io_formatter_private.c3
index 68a6bcc0b..70961813c 100644
--- a/lib/std/io/io_formatter_private.c3
+++ b/lib/std/io/io_formatter_private.c3
@@ -131,7 +131,7 @@ private fn uint simple_atoi(char* buf, usz maxlen, usz* len_ptr) @inline
 }
 
 
-private fn void! Formatter.out_substr(Formatter *this, char[] str)
+private fn void! Formatter.out_substr(Formatter *this, String str)
 {
 	usz l = conv::utf8_codepoints(str);
 	uint prec = this.prec;
@@ -415,7 +415,7 @@ private fn void! Formatter.ntoa(Formatter* this, uint128 value, bool negative, u
 	return this.ntoa_format(buf[:PRINTF_NTOA_BUFFER_SIZE], len, negative, base);
 }
 
-private fn void! Formatter.ntoa_format(Formatter* this, char[] buf, usz len, bool negative, uint base)
+private fn void! Formatter.ntoa_format(Formatter* this, String buf, usz len, bool negative, uint base)
 {
 	// pad leading zeros
 	if (!this.flags.left)
@@ -511,7 +511,7 @@ private fn void! Formatter.out_char(Formatter* this, variant arg)
 }
 
 
-private fn void! Formatter.out_reverse(Formatter* this, char[] buf)
+private fn void! Formatter.out_reverse(Formatter* this, String buf)
 {
 	usz buffer_start_idx = this.idx;
 	usz len = buf.len;
diff --git a/lib/std/io/io_printf.c3 b/lib/std/io/io_printf.c3
index e86fd4038..3069cc964 100644
--- a/lib/std/io/io_printf.c3
+++ b/lib/std/io/io_printf.c3
@@ -17,7 +17,7 @@ fault PrintFault
 
 
 define OutputFn = fn void!(char c, void* buffer);
-define ToStringFunction = fn char[](void* value, Allocator *allocator);
+define ToStringFunction = fn String(void* value, Allocator *allocator);
 define ToFormatFunction = fn void!(void* value, Formatter* formatter);
 define FloatType = double;
 
@@ -163,9 +163,9 @@ private fn void! Formatter.out_str(Formatter* this, variant arg)
 			unreachable();
 		case DISTINCT:
 			if (this.print_with_function(arg)?) return;
-			if (arg.type == String.typeid)
+			if (arg.type == VarString.typeid)
 			{
-				return this.out_substr(((String*)arg).str());
+				return this.out_substr(((VarString*)arg).str());
 			}
         	return this.out_str(variant { arg.ptr, arg.type.inner });
 		case POINTER:
@@ -188,7 +188,7 @@ private fn void! Formatter.out_str(Formatter* this, variant arg)
 			typeid inner = arg.type.inner;
 			usz size = inner.sizeof;
 			usz len = arg.type.len;
-			// Pretend this is a char[]
+			// Pretend this is a String
 			void* ptr = (void*)arg.ptr;
 			this.out('[')?;
 			for (usz i = 0; i < len; i++)
@@ -204,7 +204,7 @@ private fn void! Formatter.out_str(Formatter* this, variant arg)
 			typeid inner = arg.type.inner;
 			usz size = inner.sizeof;
 			usz len = arg.type.len;
-			// Pretend this is a char[]
+			// Pretend this is a String
 			void* ptr = (void*)arg.ptr;
 			this.out_substr("[<")?;
 			for (usz i = 0; i < len; i++)
@@ -220,11 +220,11 @@ private fn void! Formatter.out_str(Formatter* this, variant arg)
 			typeid inner = arg.type.inner;
 			if (inner == char.typeid)
 			{
-				return this.out_substr(*(char[]*)arg);
+				return this.out_substr(*(String*)arg);
 			}
 			usz size = inner.sizeof;
-            // Pretend this is a char[]
-			char[]* temp = (void*)arg.ptr;
+            // Pretend this is a String
+			String* temp = (void*)arg.ptr;
 			void* ptr = (void*)temp.ptr;
 			usz len = temp.len;
 			this.out('[')?;
@@ -283,18 +283,18 @@ private fn void! out_fputchar_fn(char c, void* data)
 
 private fn void! out_string_append_fn(char c, void* data)
 {
-	String* s = data;
+	VarString* s = data;
 	s.append_char(c);
 }
 
-fn usz! printf(char[] format, args...) @maydiscard
+fn usz! printf(String format, args...) @maydiscard
 {
 	Formatter formatter;
 	formatter.init(&out_putchar_fn);
     return formatter.vprintf(format, args);
 }
 
-fn usz! printfln(char[] format, args...) @maydiscard
+fn usz! printfln(String format, args...) @maydiscard
 {
 	Formatter formatter;
 	formatter.init(&out_putchar_fn);
@@ -303,14 +303,14 @@ fn usz! printfln(char[] format, args...) @maydiscard
 	return len + 1;
 }
 
-fn usz! String.printf(String* str, char[] format, args...) @maydiscard
+fn usz! VarString.printf(VarString* str, String format, args...) @maydiscard
 {
 	Formatter formatter;
 	formatter.init(&out_string_append_fn, str);
 	return formatter.vprintf(format, args);
 }
 
-fn usz! String.printfln(String* str, char[] format, args...) @maydiscard
+fn usz! VarString.printfln(VarString* str, String format, args...) @maydiscard
 {
 	Formatter formatter;
 	formatter.init(&out_string_append_fn, str);
@@ -325,7 +325,7 @@ private struct BufferData
 	usz written;
 }
 
-fn char[]! bprintf(char[] buffer, char[] format, args...) @maydiscard
+fn char[]! bprintf(char[] buffer, String format, args...) @maydiscard
 {
 	Formatter formatter;
 	BufferData data = { .buffer = buffer };
@@ -334,14 +334,14 @@ fn char[]! bprintf(char[] buffer, char[] format, args...) @maydiscard
 	return buffer[:size];
 }
 
-fn usz! File.printf(File file, char[] format, args...) @maydiscard
+fn usz! File.printf(File file, String format, args...) @maydiscard
 {
 	Formatter formatter;
     formatter.init(&out_putchar_fn, &file);
     return formatter.vprintf(format, args)?;
 }
 
-fn usz! File.printfln(File file, char[] format, args...) @maydiscard
+fn usz! File.printfln(File file, String format, args...) @maydiscard
 {
 	Formatter formatter;
     formatter.init(&out_putchar_fn, &file);
@@ -351,12 +351,12 @@ fn usz! File.printfln(File file, char[] format, args...) @maydiscard
 	return len + 1;
 }
 
-fn usz! Formatter.printf(Formatter* this, char[] format, args...)
+fn usz! Formatter.printf(Formatter* this, String format, args...)
 {
 	return this.vprintf(format, args) @inline;
 }
 
-fn usz! Formatter.vprintf(Formatter* this, char[] format, variant[] variants)
+fn usz! Formatter.vprintf(Formatter* this, String format, variant[] variants)
 {
 	if (!this.out_fn)
 	{
diff --git a/lib/std/io/os/getcwd.c3 b/lib/std/io/os/getcwd.c3
index 6a38da8a4..fc53b7711 100644
--- a/lib/std/io/os/getcwd.c3
+++ b/lib/std/io/os/getcwd.c3
@@ -6,7 +6,7 @@ $if (env::OS_TYPE == OsType.WIN32):
 extern fn Char16* _wgetcwd(Char16* buffer, int maxlen);
 extern fn usz wcslen(Char16* str);
 
-macro char[]! getcwd(Allocator* allocator = mem::default_allocator())
+macro String! getcwd(Allocator* allocator = mem::default_allocator())
 {
 	const DEFAULT_BUFFER = 256;
 	Char16[DEFAULT_BUFFER] buffer;
@@ -26,7 +26,7 @@ macro char[]! getcwd(Allocator* allocator = mem::default_allocator())
 $else:
 
 extern fn ZString _getcwd(char* pwd, usz len) @extname("getcwd");
-macro char[]! getcwd(Allocator* allocator = mem::default_allocator())
+macro String! getcwd(Allocator* allocator = mem::default_allocator())
 {
 	const usz DEFAULT_BUFFER = 256;
 	char[DEFAULT_BUFFER] buffer;
@@ -40,7 +40,7 @@ macro char[]! getcwd(Allocator* allocator = mem::default_allocator())
 		free = true;
 	}
 	defer if (free) libc::free((void*)res);
-	char[] copy = str::copyz(res.as_str(), allocator);
+	String copy = str::copyz(res.as_str(), allocator);
 	return copy;
 }
 
diff --git a/lib/std/runtime.c3 b/lib/std/runtime.c3
index 6283aee49..0b18d940f 100644
--- a/lib/std/runtime.c3
+++ b/lib/std/runtime.c3
@@ -32,7 +32,7 @@ define TestFn = fn void!();
 
 struct TestRunner
 {
-	char[][] test_names;
+	String[] test_names;
 	TestFn[] test_fns;
 	JmpBuf buf;
 }
@@ -48,7 +48,7 @@ fn TestRunner test_runner_create()
 import libc;
 
 private TestRunner* current_runner;
-fn void test_panic(char[] message, char[] file, char[] function, uint line)
+fn void test_panic(String message, String file, String function, uint line)
 {
 	io::println("[error]");
 	io::printfln("\n Error: %s", message);
@@ -65,7 +65,7 @@ fn bool TestRunner.run(TestRunner* runner)
 	int tests_passed = 0;
 	int tests = runner.test_names.len;
 	io::println("----- TESTS -----");
-	foreach(i, char[] name : runner.test_names)
+	foreach(i, String name : runner.test_names)
 	{
 		io::printf("Testing %s ... ", name);
 		if (libc::setjmp(&runner.buf) == 0)
diff --git a/resources/examples/base64.c3 b/resources/examples/base64.c3
index ce70cf12a..6bd7ca1f9 100644
--- a/resources/examples/base64.c3
+++ b/resources/examples/base64.c3
@@ -42,7 +42,7 @@ const char PAD = '=';
 const char FIRST = '+';
 const char LAST = 'z';
 
-fn void encode(char[] in, char *out)
+fn void encode(String in, char *out)
 {
 	int j = 0;
 	char c = LUT_ENC[1];
@@ -76,7 +76,7 @@ fn void encode(char[] in, char *out)
 }
 
 
-fn int! decode(char[] in, char* out, int* invalid_char_index = null)
+fn int! decode(String in, char* out, int* invalid_char_index = null)
 {
 	int j = 0;
 
diff --git a/resources/examples/binarydigits.c3 b/resources/examples/binarydigits.c3
index 19bdbb485..e5a77423f 100644
--- a/resources/examples/binarydigits.c3
+++ b/resources/examples/binarydigits.c3
@@ -5,16 +5,16 @@ fn void main()
 {
     for (int i = 0; i < 20; i++)
     {
-        String s = bin(i);
+        VarString s = bin(i);
         defer s.destroy();
         io::printf("%s\n", s);
     }
 }
 
-fn String bin(int x)
+fn VarString bin(int x)
 {
     int bits = 1 + (int)(x == 0 ? 0 : math::log10((double)(x)) / math::log10(2));
-    String str;
+    VarString str;
     str.append_repeat('0', bits);
     for (int i = 0; i < bits; i++)
     {
diff --git a/resources/examples/brainfk.c3 b/resources/examples/brainfk.c3
index 7781575a1..99d5e2cae 100644
--- a/resources/examples/brainfk.c3
+++ b/resources/examples/brainfk.c3
@@ -10,13 +10,13 @@ fault InterpretError
 	INTEPRET_FAILED
 }
 
-fn void! print_error(usz pos, char[] err)
+fn void! print_error(usz pos, String err)
 {
 	io::printfln("Error at %s: %s", pos, err);
 	return InterpretError.INTEPRET_FAILED!;
 }
 
-fn void! brainf(char[] program)
+fn void! brainf(String program)
 {
 	usz sp = 0;
 	usz mem = 0;
@@ -76,7 +76,7 @@ fn void! brainf(char[] program)
 }
 fn void! main()
 {
-	char[] program = `
+	String program = `
 	++++[>+++++<-]>[<+++++>-]+<+[
         >[>+>+<<-]++>>[<<+>>-]>>>[-]++>[-]+
         >>>+[[-]++++++>>>]<<<[[<++++++++<++>>-]+<.<[>----<-]<]
diff --git a/resources/examples/contextfree/boolerr.c3 b/resources/examples/contextfree/boolerr.c3
index dd32f78bc..7a0a35888 100644
--- a/resources/examples/contextfree/boolerr.c3
+++ b/resources/examples/contextfree/boolerr.c3
@@ -3,11 +3,11 @@ import libc;
 import std::io;
 
 struct Doc { Head *head; }
-struct Head { String* title; }
+struct Head { VarString* title; }
 
 struct Summary
 {
-	String* title;
+	VarString* title;
 	bool ok;
 }
 
@@ -21,11 +21,11 @@ private struct StringData
 
 fn void Summary.print(Summary *s, File out)
 {
-	char[] title = s.title ? s.title.str() : "missing";
+	String title = s.title ? s.title.str() : "missing";
 	out.printf("Summary({ .title = %s, .ok = %s})", title, s.ok);
 }
 
-fn bool contains(char[] haystack, char[] needle)
+fn bool contains(String haystack, String needle)
 {
 	usz len = haystack.len;
 	usz needle_len = needle.len;
@@ -54,13 +54,13 @@ fault ReadError
 	BAD_READ,
 }
 
-fn Doc! readDoc(char[] url)
+fn Doc! readDoc(String url)
 {
 	if (contains(url, "fail")) return ReadError.BAD_READ!;
 	if (contains(url, "head-missing")) return { .head = null };
 	if (contains(url, "title-missing")) return { @dupe(Head { .title = null }) };
-	if (contains(url, "title-empty")) return { @dupe(Head { .title = @dupe((String)null) }) };
-	String str;
+	if (contains(url, "title-empty")) return { @dupe(Head { .title = @dupe((VarString)null) }) };
+	VarString str;
 	str.printf("Title of %s", url);
 	return { @dupe(Head { .title = @dupe(str) }) };
 }
@@ -73,7 +73,7 @@ fn Summary buildSummary(Doc doc)
     };
 }
 
-fn Summary readAndBuildSummary(char[] url)
+fn Summary readAndBuildSummary(String url)
 {
 	return buildSummary(readDoc(url)) ?? Summary { .title = null, .ok = false };
 	/*
@@ -97,18 +97,18 @@ fault TitleResult
 fn bool! isTitleNonEmpty(Doc doc)
 {
 	if (!doc.head) return TitleResult.TITLE_MISSING!;
-	String* head = doc.head.title;
+	VarString* head = doc.head.title;
 	if (!head) return TitleResult.TITLE_MISSING!;
 	return head.len() > 0;
 }
 
 
-fn bool! readWhetherTitleNonEmpty(char[] url)
+fn bool! readWhetherTitleNonEmpty(String url)
 {
     return isTitleNonEmpty(readDoc(url));
 }
 
-fn char[] bool_to_string(bool b)
+fn String bool_to_string(bool b)
 {
 	return b ? "true" : "false";
 }
@@ -116,10 +116,10 @@ fn char[] bool_to_string(bool b)
 
 fn void main()
 {
-    const char[][] URLS = { "good", "title-empty", "title-missing", "head-missing", "fail" };
+    const String[] URLS = { "good", "title-empty", "title-missing", "head-missing", "fail" };
     DynamicArenaAllocator dynamic_arena;
 	dynamic_arena.init(1024);
-    foreach (char[] url : URLS)
+    foreach (String url : URLS)
     {
         mem::@scoped(&dynamic_arena)
         {
@@ -128,7 +128,7 @@ fn void main()
             io::printf("  Summary: ");
             summary.print(io::stdout());
             io::println("");
-            char[] title_sure = summary.title ? summary.title.str() : "";
+            String title_sure = summary.title ? summary.title.str() : "";
             io::printf("  Title: %s\n", title_sure);
             bool! has_title = readWhetherTitleNonEmpty(url);
             // This looks a bit less than elegant, but as you see it's mostly due to having to
diff --git a/resources/examples/contextfree/dynscope.c3 b/resources/examples/contextfree/dynscope.c3
index f5ce2174e..387018a5c 100644
--- a/resources/examples/contextfree/dynscope.c3
+++ b/resources/examples/contextfree/dynscope.c3
@@ -1,7 +1,7 @@
 module foo;
 import std::io;
 
-tlocal char[] context_user = "safe";
+tlocal String context_user = "safe";
 
 macro long reallyPerform(task)
 {
@@ -14,7 +14,7 @@ macro long perform(task)
 	return reallyPerform(task);
 }
 
-macro @with_mode(char[] user, #action, ...)
+macro @with_mode(String user, #action, ...)
 {
 	@scope(context_user)
 	{
@@ -27,6 +27,6 @@ fn void main()
 {
 	long val1 = perform("something");
 	long val2 = @with_mode("faster", perform, "reliable");
-	long val3 = perform(char[][] {"something"});
+	long val3 = perform(String[] {"something"});
 	io::printfln("%d %d %d", val1, val2, val3);
 }
diff --git a/resources/examples/contextfree/guess_number.c3 b/resources/examples/contextfree/guess_number.c3
index 576bacc12..1ba110b94 100644
--- a/resources/examples/contextfree/guess_number.c3
+++ b/resources/examples/contextfree/guess_number.c3
@@ -23,14 +23,14 @@ int err_count = 0;
 fn int! askGuess(int high)
 {
 	libc::printf("Guess a number between 1 and %d: ", high);
-	char[] text = readLine()?;
+	String text = readLine()?;
 	char* end = null;
 	int value = (int)libc::strtol(text.ptr, &end, 10);
 	if (end && end[0] >= ' ') return InputResult.NOT_AN_INT!;
 	return value;
 }
 
-fn char[]! readLine()
+fn String! readLine()
 {
 	char* chars = tmalloc(1024)?;
 	isz loaded = getline(&chars, &&(usz)1023, libc::stdin());
@@ -67,7 +67,7 @@ fn void! Game.play(Game *game)
 
 fn void Game.report(Game *game, int guess)
 {
-	char[] desc = {|
+	String desc = {|
 		if (guess < game.answer) return "too low";
 		if (guess > game.answer) return "too high";
 		return "the answer";
diff --git a/resources/examples/contextfree/multi.c3 b/resources/examples/contextfree/multi.c3
index 002556270..6071a1d2b 100644
--- a/resources/examples/contextfree/multi.c3
+++ b/resources/examples/contextfree/multi.c3
@@ -9,7 +9,7 @@ fn void main()
     	    And a nested comment.
     	*/
     */
-	char[] text = `
+	String text = `
  		function hello() {
  		  console.log("name`"\t"`age");
  		}
diff --git a/resources/examples/fasta.c3 b/resources/examples/fasta.c3
index 4faba77f7..8069a93d2 100644
--- a/resources/examples/fasta.c3
+++ b/resources/examples/fasta.c3
@@ -15,7 +15,7 @@ fn float fasta_rand(float max_val)
 	return max_val * seed / IM;
 }
 
-private char[] alu =
+private String alu =
 	"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"
 	"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"
 	"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"
@@ -25,7 +25,7 @@ private char[] alu =
 	"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
 
 
-char[] iub = "acgtBDHKMNRSVWY";
+String iub = "acgtBDHKMNRSVWY";
 double[] iub_p = {
 	0.27,
 	0.12,
@@ -43,7 +43,7 @@ double[] iub_p = {
 	0.02,
 	0.02 };
 
-char[] homosapiens = "acgt";
+String homosapiens = "acgt";
 double[] homosapiens_p = {
 	0.3029549426680,
 	0.1979883004921,
@@ -54,7 +54,7 @@ double[] homosapiens_p = {
 const LINELEN = 60;
 
 // slowest character-at-a-time output
-fn void repeat_fasta(char[] seq, int n)
+fn void repeat_fasta(String seq, int n)
 {
 	usz len = seq.len;
 	int i = void;
@@ -66,7 +66,7 @@ fn void repeat_fasta(char[] seq, int n)
 	if (i % LINELEN != 0) io::putchar('\n');
 }
 
-fn void random_fasta(char[] symb, double[] probability, int n)
+fn void random_fasta(String symb, double[] probability, int n)
 {
 	assert(symb.len == probability.len);
 	int len = probability.len;
diff --git a/resources/examples/hash.c3 b/resources/examples/hash.c3
index f20f09971..b8521b2f1 100644
--- a/resources/examples/hash.c3
+++ b/resources/examples/hash.c3
@@ -7,7 +7,7 @@ import libc;
 
 fn void main()
 {
-    char[] y = "Hello World!";
+    String y = "Hello World!";
     libc::printf("Adler32 of %s is %x, expected 1c49043e\n", (char*)(y), adler32(y));
     libc::printf("CRC32B of %s is %x, expected 1c291ca3\n", (char*)(y), crc32(y));
     libc::printf("CRC64 of %s is %llx, expected fad9a77c67077205\n", (char*)(y), crc64(y));
diff --git a/resources/examples/hello_world_many.c3 b/resources/examples/hello_world_many.c3
index b37edf2a8..3ceaadeb2 100644
--- a/resources/examples/hello_world_many.c3
+++ b/resources/examples/hello_world_many.c3
@@ -2,7 +2,7 @@ import std::io;
 
 fn void main()
 {
-    char[][] greetings = {
+    String[] greetings = {
         "Hello, world!",
         "¡Hola Mundo!",
         "Γειά σου Κόσμε!",
diff --git a/resources/examples/levenshtein.c3 b/resources/examples/levenshtein.c3
index d7caa695f..7ee37e900 100644
--- a/resources/examples/levenshtein.c3
+++ b/resources/examples/levenshtein.c3
@@ -2,7 +2,7 @@ module levenshtein;
 import std::math;
 
 // This levenshtein exercises C3 subarrays.
-fn int levenshtein(char[] s, char[] t)
+fn int levenshtein(String s, String t)
 {
 	// if either string is empty, difference is inserting all chars
 	// from the other
diff --git a/resources/examples/nbodies.c3 b/resources/examples/nbodies.c3
index c0a83d8e3..03fa1db48 100644
--- a/resources/examples/nbodies.c3
+++ b/resources/examples/nbodies.c3
@@ -142,7 +142,7 @@ fn void scale_bodies(Planet[] bodies, double scale)
 }
 
 
-fn void main(char[][] args)
+fn void main(String[] args)
 {
 	int n = args.len < 2 ? 50000000 : str::to_int(args[1])!!;
 
diff --git a/resources/examples/notworking/madlibs.c3 b/resources/examples/notworking/madlibs.c3
index 1a6dbe684..194d02e3c 100644
--- a/resources/examples/notworking/madlibs.c3
+++ b/resources/examples/notworking/madlibs.c3
@@ -4,10 +4,10 @@ import regex, stdio;
 fn void main()
 {
     println("Enter a story template, terminated by an empty line:");
-    String story = "";
+    VarString story = "";
     while (1)
     {
-        String line = stdin.readln().strip() else break;
+        VarString line = stdin.readln().strip() else break;
         story = story.append(line);
         story = story.append("\n");
     }
@@ -19,7 +19,7 @@ fn void main()
 
     foreach (RegexMatch* match : r.match(story))
     {
-        String s = match.string;
+        VarString s = match.string;
         printf("Enter a value for '%s': ", s[1..^2]);
         string word = stdin.readln().strip() else return;
         story = story.replace(s, word);
diff --git a/resources/examples/notworking/toml_tokenizer_c2.c3 b/resources/examples/notworking/toml_tokenizer_c2.c3
index 9c28afa8c..663b53724 100644
--- a/resources/examples/notworking/toml_tokenizer_c2.c3
+++ b/resources/examples/notworking/toml_tokenizer_c2.c3
@@ -7,7 +7,7 @@ import stdlib;
 
 const uint MaxText = 1024;
 
-enum TokenKind : char (String name)
+enum TokenKind : char (VarString name)
 {
     WORD("word"),
     TEXT("text"),
diff --git a/resources/examples/plus_minus.c3 b/resources/examples/plus_minus.c3
index 767ac5f7b..674f67818 100644
--- a/resources/examples/plus_minus.c3
+++ b/resources/examples/plus_minus.c3
@@ -10,15 +10,15 @@ fault TokenResult
 
 // While we could have written this with libc
 // the C way, let's showcase some features added to C3.
-fn void main(char[][] args)
+fn void main(String[] args)
 {
 	// Grab a string from stdin
-	String s = io::stdin().getline();
+	VarString s = io::stdin().getline();
 	// Delete it at scope end [defer]
 	defer s.destroy();
 
 	// Grab the string as a slice.
-	char[] numbers = s.str();
+	String numbers = s.str();
 
 	// Track our current value
 	int val = 0;
@@ -26,7 +26,7 @@ fn void main(char[][] args)
 	// Is the current state an add?
 	bool add = true;
 
-	while (try char[] token = read_next(&numbers))
+	while (try String token = read_next(&numbers))
 	{
 		// We're assuming well formed input here
 		// so just use atoi.
@@ -36,7 +36,7 @@ fn void main(char[][] args)
 		val = add ? val + i : val - i;
 
 		// Read an optional token.
-		char[]! op = read_next(&numbers);
+		String! op = read_next(&numbers);
 
 		// If it's an error, then we're done.
 		if (catch op) break;
@@ -56,7 +56,7 @@ fn void main(char[][] args)
 	io::printfln("%d", val);
 }
 
-fn char[]! read_next(char[]* remaining)
+fn String! read_next(String* remaining)
 {
 	while (remaining.len > 0 && (*remaining)[0] == ' ')
 	{
diff --git a/resources/examples/spectralnorm.c3 b/resources/examples/spectralnorm.c3
index 95945c215..ebc6463f9 100644
--- a/resources/examples/spectralnorm.c3
+++ b/resources/examples/spectralnorm.c3
@@ -42,7 +42,7 @@ fn void eval_AtA_times_u(double[] u, double[] atau, double[] x)
 	eval_At_times_u(temparr, atau, x);
 }
 
-fn void main(char[][] args)
+fn void main(String[] args)
 {
 	int n = args.len == 2 ? str::to_int(args[1])!! : 2000;
 	temparr = array::alloc(double, n);
diff --git a/resources/testfragments/allocators_testing.c3 b/resources/testfragments/allocators_testing.c3
index f22a72dd9..b1f55d22a 100644
--- a/resources/testfragments/allocators_testing.c3
+++ b/resources/testfragments/allocators_testing.c3
@@ -12,7 +12,7 @@ fn void print_pages()
 	mem::temp_allocator().print_pages(io::stdout());
 }
 
-fn void setstring(char* dst, char[] str)
+fn void setstring(char* dst, String str)
 {
 	foreach (char c : str)
 	{
diff --git a/resources/testfragments/parsertest.c3 b/resources/testfragments/parsertest.c3
index 7051223bf..545cf6ea7 100644
--- a/resources/testfragments/parsertest.c3
+++ b/resources/testfragments/parsertest.c3
@@ -143,7 +143,7 @@ $else
 
 generic boofer2(i, g, eok)
 {
-    case int, char[], type($eoo):
+    case int, String, type($eoo):
         return "Helo";
     default:
         return 1000;
diff --git a/resources/testfragments/tmem.c3 b/resources/testfragments/tmem.c3
index c5a44fe76..ace0ec9a8 100644
--- a/resources/testfragments/tmem.c3
+++ b/resources/testfragments/tmem.c3
@@ -2,7 +2,7 @@ module tmem;
 import std::mem;
 import std::io;
 
-struct String
+struct VarString
 {
     Allocator allocator;
     usz len;
@@ -10,7 +10,7 @@ struct String
     char* ptr;
 }
 
-fn void String.init(String *s, char[] c)
+fn void VarString.init(VarString *s, String c)
 {
     s.capacity = c.len + 16;
     s.ptr = malloc(s.capacity);
@@ -18,7 +18,7 @@ fn void String.init(String *s, char[] c)
     mem::copy(s.ptr, (char*)(c), c.len);
 }
 
-fn char* String.zstr(String *s)
+fn char* VarString.zstr(VarString *s)
 {
     char* c = malloc(s.len + 1);
     mem::copy(c, s.ptr, s.len);
@@ -26,7 +26,7 @@ fn char* String.zstr(String *s)
     return c;
 }
 
-fn void String.appendc(String *s, char c)
+fn void VarString.appendc(VarString *s, char c)
 {
     if (s.capacity == s.len)
     {
@@ -38,7 +38,7 @@ fn void String.appendc(String *s, char c)
     s.ptr[s.len++] = c;
 }
 
-fn void String.append(String *s, char[] other_string)
+fn void VarString.append(VarString *s, String other_string)
 {
     if (s.capacity < s.len + other_string.len)
     {
@@ -55,7 +55,7 @@ fn void String.append(String *s, char[] other_string)
     s.len += other_string.len;
 }
 
-fn void String.concat(String *s, String* other_string)
+fn void VarString.concat(VarString *s, VarString* other_string)
 {
     if (s.capacity < s.len + other_string.len)
     {
@@ -74,12 +74,12 @@ fn void String.concat(String *s, String* other_string)
 
 fn void main()
 {
-    String s;
+    VarString s;
     s.init("Hello");
     s.appendc(' ');
     s.appendc('W');
     s.append("orld!");
-    String w;
+    VarString w;
     w.init("Yo man!");
     s.concat(&w);
     libc::printf("Message was: %s\n", s.zstr());
diff --git a/resources/testproject/project.json b/resources/testproject/project.json
index a8613401f..821bba493 100644
--- a/resources/testproject/project.json
+++ b/resources/testproject/project.json
@@ -27,7 +27,6 @@
     "hello_world_win32": {
       "type": "executable",
       "c-sources-override": [
-        "./csource/**"
       ]
     },
     "hello_world_lib": {
diff --git a/src/compiler/compiler.c b/src/compiler/compiler.c
index d0822a910..c42bbda01 100644
--- a/src/compiler/compiler.c
+++ b/src/compiler/compiler.c
@@ -750,6 +750,7 @@ void compile()
 	}
 	global_context.sources = active_target.sources;
 	global_context.main = NULL;
+	global_context.string_type = NULL;
 	asm_target.initialized = false;
 	target_setup(&active_target);
 	resolve_libraries();
diff --git a/src/compiler/compiler_internal.h b/src/compiler/compiler_internal.h
index e84d53b92..565f79f1d 100644
--- a/src/compiler/compiler_internal.h
+++ b/src/compiler/compiler_internal.h
@@ -1666,12 +1666,13 @@ typedef struct
 	DeclTable symbols;
 	DeclTable generic_symbols;
 	Path std_module_path;
+	Type *string_type;
 	Decl *panic_var;
 	Decl *main;
 	Decl *test_func;
 	Decl *decl_stack[MAX_GLOBAL_DECL_STACK];
-	Decl** decl_stack_bottom;
-	Decl** decl_stack_top;
+	Decl **decl_stack_bottom;
+	Decl **decl_stack_top;
 } GlobalContext;
 
 
@@ -2259,6 +2260,7 @@ void decltable_set(DeclTable *table, Decl *decl);
 
 const char *scratch_buffer_interned(void);
 
+const char *symtab_preset(const char *data, TokenType type);
 const char *symtab_add(const char *symbol, uint32_t len, uint32_t fnv1hash, TokenType *type);
 const char *symtab_find(const char *symbol, uint32_t len, uint32_t fnv1hash, TokenType *type);
 void *llvm_target_machine_create(void);
diff --git a/src/compiler/llvm_codegen.c b/src/compiler/llvm_codegen.c
index 9824e70d1..251cde58f 100644
--- a/src/compiler/llvm_codegen.c
+++ b/src/compiler/llvm_codegen.c
@@ -1065,10 +1065,10 @@ INLINE GenContext *llvm_gen_tests(Module** modules, unsigned module_count, LLVMC
 	unsigned test_count = vec_size(decls);
 	LLVMValueRef name_ref;
 	LLVMValueRef decl_ref;
-	LLVMTypeRef chars_type = llvm_get_type(c, type_chars);
+
 	if (test_count)
 	{
-		LLVMValueRef array_of_names = LLVMConstArray(chars_type, names, test_count);
+		LLVMValueRef array_of_names = LLVMConstArray(c->chars_type, names, test_count);
 		LLVMValueRef array_of_decls = LLVMConstArray(LLVMPointerType(opt_test, 0), decls, test_count);
 		LLVMTypeRef arr_type = LLVMTypeOf(array_of_names);
 		name_ref = llvm_add_global_raw(c, ".test_names", arr_type, 0);
diff --git a/src/compiler/llvm_codegen_module.c b/src/compiler/llvm_codegen_module.c
index 3a4519646..446c3c973 100644
--- a/src/compiler/llvm_codegen_module.c
+++ b/src/compiler/llvm_codegen_module.c
@@ -27,7 +27,7 @@ static inline LLVMTypeRef create_fault_type(GenContext *c)
 {
 	LLVMTypeRef type = LLVMStructCreateNamed(c->context, ".fault");
 	LLVMTypeRef typeid_type = llvm_get_type(c, type_typeid);
-	LLVMTypeRef chars_type = llvm_get_type(c, type_chars);
+	LLVMTypeRef chars_type = c->chars_type;
 	LLVMTypeRef fault_type[] = {
 			[0] = typeid_type,
 			[1] = chars_type,
@@ -123,11 +123,11 @@ void gencontext_begin_module(GenContext *c)
 	}
 	c->bool_type = LLVMInt1TypeInContext(c->context);
 	c->byte_type = LLVMInt8TypeInContext(c->context);
+	c->chars_type = llvm_get_type(c, type_chars);
 	c->introspect_type = create_introspection_type(c);
 	c->fault_type = create_fault_type(c);
 	c->size_type = llvm_get_type(c, type_usize);
 	c->char_ptr_type = LLVMPointerType(c->byte_type, 0);
-	c->chars_type = llvm_get_type(c, type_chars);
 	if (c->panic_var) c->panic_var->backend_ref = NULL;
 
 	if (active_target.debug_info != DEBUG_INFO_NONE)
diff --git a/src/compiler/llvm_codegen_stmt.c b/src/compiler/llvm_codegen_stmt.c
index fc4309e75..441b23d97 100644
--- a/src/compiler/llvm_codegen_stmt.c
+++ b/src/compiler/llvm_codegen_stmt.c
@@ -1245,13 +1245,13 @@ LLVMValueRef llvm_emit_string_const(GenContext *c, const char *str, const char *
 	if (!len) return llvm_emit_empty_string_const(c);
 	LLVMValueRef val = llvm_emit_zstring_named(c, str, extname);
 	LLVMValueRef data[2] = { val, llvm_const_int(c, type_usize, strlen(str)) };
-	return llvm_get_struct_named(llvm_get_type(c, type_chars), data, 2);
+	return llvm_get_struct_named(c->chars_type, data, 2);
 }
 
 LLVMValueRef llvm_emit_empty_string_const(GenContext *c)
 {
 	LLVMValueRef data[2] = { LLVMConstNull(c->char_ptr_type), llvm_const_int(c, type_usize, 0) };
-	return llvm_get_struct_named(llvm_get_type(c, type_chars), data, 2);
+	return llvm_get_struct_named(c->chars_type, data, 2);
 }
 
 LLVMValueRef llvm_emit_zstring(GenContext *c, const char *str)
diff --git a/src/compiler/llvm_codegen_type.c b/src/compiler/llvm_codegen_type.c
index 76d88340d..c2160179e 100644
--- a/src/compiler/llvm_codegen_type.c
+++ b/src/compiler/llvm_codegen_type.c
@@ -556,7 +556,6 @@ static LLVMValueRef llvm_get_introspection_for_enum(GenContext *c, Type *type)
 
 	if (!is_dynamic) is_external = false;
 
-	LLVMTypeRef subarray = llvm_get_type(c, type_chars);
 	LLVMValueRef *values = elements ? malloc_arena(elements * sizeof(LLVMValueRef)) : NULL;
 
 	bool obfuscate = decl->obfuscate;
@@ -574,7 +573,7 @@ static LLVMValueRef llvm_get_introspection_for_enum(GenContext *c, Type *type)
 		}
 		values[i] = llvm_emit_string_const(c, name, scratch_buffer_to_string());
 	}
-	LLVMValueRef names = llvm_get_array(subarray, values, elements);
+	LLVMValueRef names = llvm_get_array(c->chars_type, values, elements);
 
 	LLVMValueRef val = llvm_generate_introspection_global(c, NULL, type, INTROSPECT_TYPE_ENUM, type_flatten(type), elements, names, is_external);
 	LLVMTypeRef val_type;
diff --git a/src/compiler/sema_casts.c b/src/compiler/sema_casts.c
index 96d415dcb..3697fc6d3 100644
--- a/src/compiler/sema_casts.c
+++ b/src/compiler/sema_casts.c
@@ -516,7 +516,7 @@ static bool cast_may_explicit(Type *from_type, Type *to_type, bool is_const)
 			// Allow conversion float -> float/int/bool/enum
 			return type_is_integer(to_type) || type_is_float(to_type) || to_type == type_bool || to_kind == TYPE_ENUM;
 		case TYPE_POINTER:
-			UNREACHABLE
+			return type_is_pointer_sized_or_more(to_type) || to_type == type_bool;
 		case TYPE_ANY:
 			return to_kind == TYPE_POINTER;
 		case TYPE_FAULTTYPE:
diff --git a/src/compiler/sema_expr.c b/src/compiler/sema_expr.c
index fff1a73fb..71f8b8df5 100644
--- a/src/compiler/sema_expr.c
+++ b/src/compiler/sema_expr.c
@@ -2736,7 +2736,7 @@ static inline void sema_expr_replace_with_enum_name_array(Expr *enum_array_expr,
 	initializer->initializer_list = element_values;
 	enum_array_expr->expr_kind = EXPR_COMPOUND_LITERAL;
 	enum_array_expr->expr_compound_literal.initializer = initializer;
-	enum_array_expr->expr_compound_literal.type_info = type_info_new_base(type_get_subarray(type_chars), span);
+	enum_array_expr->expr_compound_literal.type_info = type_info_new_base(type_get_subarray(global_context_string_type()), span);
 	enum_array_expr->resolve_status = RESOLVE_NOT_DONE;
 }
 
@@ -3210,7 +3210,7 @@ static bool sema_expr_rewrite_to_typeid_property(SemaContext *context, Expr *exp
 			sema_expr_rewrite_typeid_kind(expr, typeid);
 			return true;
 		case TYPE_PROPERTY_NAMES:
-			return sema_expr_rewrite_typeid_call(expr, typeid, TYPEID_INFO_NAMES, type_get_subarray(type_chars));
+			return sema_expr_rewrite_typeid_call(expr, typeid, TYPEID_INFO_NAMES, type_get_subarray(global_context_string_type()));
 		case TYPE_PROPERTY_ALIGNOF:
 		case TYPE_PROPERTY_INF:
 		case TYPE_PROPERTY_MIN:
@@ -3516,7 +3516,7 @@ CHECK_DEEPER:
 			}
 			else
 			{
-				expr_rewrite_to_builtin_access(expr, current_parent, ACCESS_ENUMNAME, type_chars);
+				expr_rewrite_to_builtin_access(expr, current_parent, ACCESS_ENUMNAME, global_context_string_type());
 				return true;
 			}
 		}
@@ -3527,7 +3527,7 @@ CHECK_DEEPER:
 				expr_rewrite_to_string(expr, current_parent->const_expr.enum_err_val->name);
 				return true;
 			}
-			expr_rewrite_to_builtin_access(expr, current_parent, ACCESS_FAULTNAME, type_chars);
+			expr_rewrite_to_builtin_access(expr, current_parent, ACCESS_FAULTNAME, global_context_string_type());
 			return true;
 		}
 	}
@@ -6004,10 +6004,10 @@ static inline bool sema_expr_analyse_compiler_const(SemaContext *context, Expr *
 				expr->expr_kind = EXPR_CONST;
 				ConstInitializer *init = expr->const_expr.initializer = CALLOCS(ConstInitializer);
 				init->kind = CONST_INIT_ZERO;
-				init->type = expr->type = type_get_subarray(type_chars);
+				init->type = expr->type = type_get_subarray(global_context_string_type());
 				return true;
 			}
-			expr->type = type_get_subarray(type_chars);
+			expr->type = type_get_subarray(global_context_string_type());
 			expr->test_hook_expr = BUILTIN_DEF_TEST_NAMES;
 			expr->expr_kind = EXPR_TEST_HOOK;
 			return true;
@@ -6802,7 +6802,7 @@ static inline bool sema_analyse_expr_dispatch(SemaContext *context, Expr *expr)
 			if (!sema_expr_analyse_ct_stringify(context, expr)) return false;
 			return true;
 		case EXPR_ARGV_TO_SUBARRAY:
-			expr->type = type_get_subarray(type_chars);
+			expr->type = type_get_subarray(global_context_string_type());
 			return true;
 		case EXPR_DECL:
 			if (!sema_analyse_var_decl(context, expr->decl_expr, true)) return false;
diff --git a/src/compiler/sema_internal.h b/src/compiler/sema_internal.h
index cedb287ee..0dbf69e73 100644
--- a/src/compiler/sema_internal.h
+++ b/src/compiler/sema_internal.h
@@ -48,6 +48,7 @@ extern const char *ct_eval_error;
 
 Decl **global_context_acquire_locals_list(void);
 void generic_context_release_locals_list(Decl **);
+Type *global_context_string_type(void);
 
 AstId context_get_defers(SemaContext *context, AstId defer_top, AstId defer_bottom);
 void context_pop_defers(SemaContext *context, AstId *next);
diff --git a/src/compiler/semantic_analyser.c b/src/compiler/semantic_analyser.c
index a28cd408b..49c771af0 100644
--- a/src/compiler/semantic_analyser.c
+++ b/src/compiler/semantic_analyser.c
@@ -224,6 +224,20 @@ static void sema_analyze_to_stage(AnalysisStage stage)
 	halt_on_error();
 }
 
+Type *global_context_string_type(void)
+{
+	if (global_context.string_type) return global_context.string_type;
+	DeclId type = decltable_get(&global_context.symbols, symtab_preset("String", TOKEN_TYPE_IDENT));
+	if (!type) error_exit("Missing definition of 'String' type.");
+	Decl *decl = declptr(type);
+	if (decl->decl_kind == DECL_TYPEDEF || decl->decl_kind == DECL_DISTINCT)
+	{
+		if (type_flatten(decl->type) == type_chars) return global_context.string_type = decl->type;
+
+	}
+	error_exit("Invalid definition of String, expected a type with an underlying char[]");
+}
+
 /**
  * Perform the entire semantic analysis.
  */
@@ -266,7 +280,6 @@ void sema_analysis_run(void)
 	// Set a maximum of symbols in the std_module and test module
 	htable_init(&global_context.std_module.symbols, 0x10000);
 
-
 	// Setup the func prototype hash map
 	type_func_prototype_init(0x10000);
 
@@ -312,9 +325,10 @@ void sema_analysis_run(void)
 		{
 			error_exit("'%s::%s' is not a function pointer.", path->module, ident);
 		}
-		if (!type_func_match(panic_fn_type, type_void, 4, type_chars, type_chars, type_chars, type_uint))
+		Type *string = global_context_string_type();
+		if (!type_func_match(panic_fn_type, type_void, 4, string, string, string, type_uint))
 		{
-			error_exit("Expected panic function to have the signature fn void(char[], char[], char[], uint).");
+			error_exit("Expected panic function to have the signature fn void(String, String, String, uint).");
 		}
 		global_context.panic_var = decl;
 	}
diff --git a/src/compiler/symtab.c b/src/compiler/symtab.c
index 04d45ce18..d08f697af 100644
--- a/src/compiler/symtab.c
+++ b/src/compiler/symtab.c
@@ -336,6 +336,15 @@ const char *symtab_find(const char *symbol, uint32_t len, uint32_t fnv1hash, Tok
 	return NULL;
 }
 
+const char *symtab_preset(const char *data, TokenType type)
+{
+	uint32_t len = (uint32_t)strlen(data);
+	TokenType result = type;
+	const char *res = symtab_add(data, len, fnv1a(data, len), &result);
+	assert(result == type);
+	return res;
+}
+
 const char *symtab_add(const char *data, uint32_t len, uint32_t fnv1hash, TokenType *type)
 {
 	size_t pos = fnv1hash & symtab.bucket_mask;
diff --git a/src/compiler/types.c b/src/compiler/types.c
index 9be3cc780..0018fbe26 100644
--- a/src/compiler/types.c
+++ b/src/compiler/types.c
@@ -8,9 +8,9 @@ static Type *flatten_raw_function_type(Type *type);
 
 static struct
 {
-	Type u0, u1, i8, i16, i32, i64, i128, ixx;
+	Type u0, u1, i8, i16, i32, i64, i128;
 	Type u8, u16, u32, u64, u128;
-	Type f16, f32, f64, f128, fxx;
+	Type f16, f32, f64, f128;
 	Type usz, isz, usize, isize, uptr, iptr;
 	Type voidstar, typeid, anyerr, member, typeinfo, untyped_list;
 	Type any, anyfail;
diff --git a/src/main.c b/src/main.c
index 83c09fe3b..ee7317e49 100644
--- a/src/main.c
+++ b/src/main.c
@@ -99,7 +99,7 @@ int wmain(int argc, const uint16_t *argv[])
 	{
 		args[i] = win_utf16to8(argv[i]);
 	}
-	main_real(argc, (const char **)args);
+	return main_real(argc, (const char **)args);
 }
 
 #else
diff --git a/src/version.h b/src/version.h
index d269ee8d8..a1ef5e27c 100644
--- a/src/version.h
+++ b/src/version.h
@@ -1 +1 @@
-#define COMPILER_VERSION "0.4.6"
\ No newline at end of file
+#define COMPILER_VERSION "0.4.7"
\ No newline at end of file
diff --git a/test/test_suite/contracts/ct_eval_of_ensure.c3 b/test/test_suite/contracts/ct_eval_of_ensure.c3
index 1d53e2992..7c8209999 100644
--- a/test/test_suite/contracts/ct_eval_of_ensure.c3
+++ b/test/test_suite/contracts/ct_eval_of_ensure.c3
@@ -8,7 +8,7 @@ fn int test(int baz)
 }
 
 extern fn void printf(char*, ...);
-fn void main(char[][] args)
+fn void main(String[] args)
 {
    test(1022);
    printf("Hello\n");
diff --git a/test/test_suite/define/test_at.c3 b/test/test_suite/define/test_at.c3
index 520e9c591..a48b1bb20 100644
--- a/test/test_suite/define/test_at.c3
+++ b/test/test_suite/define/test_at.c3
@@ -12,6 +12,6 @@ import private foo;
 define intHello = foo::@hello<int>; // #error: cannot be aliased
 define @intHello = foo::hello<int>; // #error: cannot use
 
-fn void main(char[][] args) {
+fn void main(String[] args) {
     @intHello(42);
 }
\ No newline at end of file
diff --git a/test/test_suite/define/test_at_alias.c3 b/test/test_suite/define/test_at_alias.c3
index f0414ff44..f453dc948 100644
--- a/test/test_suite/define/test_at_alias.c3
+++ b/test/test_suite/define/test_at_alias.c3
@@ -11,6 +11,6 @@ import private foo;
 
 define @intHello = foo::@hello<int>;
 
-fn void main(char[][] args) {
+fn void main(String[] args) {
     @intHello(42);
 }
\ No newline at end of file
diff --git a/test/test_suite/globals/global_init.c3 b/test/test_suite/globals/global_init.c3
index b3cd2bd2c..eec62d316 100644
--- a/test/test_suite/globals/global_init.c3
+++ b/test/test_suite/globals/global_init.c3
@@ -1,6 +1,6 @@
 // TODO string str = "hello";
 char* str2 = "hello";
-char[] str3 = "hello";
+String str3 = "hello";
 
 
 int[2] a1 = { 1, 2 };
diff --git a/test/test_suite/initializer_lists/disallowed_lists.c3 b/test/test_suite/initializer_lists/disallowed_lists.c3
index abfcb2617..6f2225099 100644
--- a/test/test_suite/initializer_lists/disallowed_lists.c3
+++ b/test/test_suite/initializer_lists/disallowed_lists.c3
@@ -1,7 +1,7 @@
 fn void test()
 {
     char* hello = "123";
-    char[] a = { '1', '2', '3' };
+    String a = { '1', '2', '3' };
     char[*] b = { '1', '2', '3' };
     char[3] c = { '1', '2', '3' };
     char* d = { '1', '2', '3' }; // #error: Pointers cannot be initialized using an initializer list, instead you need to take the address of an array
diff --git a/test/test_suite/methods/extension_method_generic.c3 b/test/test_suite/methods/extension_method_generic.c3
index ab13e4eb1..35c460999 100644
--- a/test/test_suite/methods/extension_method_generic.c3
+++ b/test/test_suite/methods/extension_method_generic.c3
@@ -10,7 +10,7 @@ fn void IntArray.someFunc(IntArray *this, usz param) {
     this.push((int)param);
 }
 
-fn int main(char[][] argv)
+fn int main(String[] argv)
 {
     IntArray stk;
     stk.someFunc(256);
diff --git a/test/test_suite/stdlib/map.c3t b/test/test_suite/stdlib/map.c3t
index 2cf149c0c..d8065b054 100644
--- a/test/test_suite/stdlib/map.c3t
+++ b/test/test_suite/stdlib/map.c3t
@@ -11,7 +11,7 @@ define IntDoubleMap = std::map::HashMap<int, double>;
 
 fn char[] Foo.to_string(Foo* foo, Allocator* allocator = mem::current_allocator())
 {
-	String s = string::new_with_capacity(128, allocator);
+	VarString s = string::new_with_capacity(128, allocator);
 	s.printf("{%s, %p}", foo.x, foo.bar);
 	return s.str();
 }
@@ -109,7 +109,7 @@ entry:
   %lo = load i8*, i8** %17, align 8
   %18 = getelementptr inbounds { i8*, i64 }, { i8*, i64 }* %16, i32 0, i32 1
   %hi = load i64, i64* %18, align 8
-  %19 = call i64 @std_core_string_String_printf(i64* %retparam, i8** %s, i8* getelementptr inbounds ([9 x i8], [9 x i8]* @.str.12, i32 0, i32 0), i64 8, i8* %lo, i64 %hi)
+  %19 = call i64 @std_core_string_VarString_printf(i64* %retparam, i8** %s, i8* getelementptr inbounds ([9 x i8], [9 x i8]* @.str.12, i32 0, i32 0), i64 8, i8* %lo, i64 %hi)
   %not_err = icmp eq i64 %19, 0
   br i1 %not_err, label %after_check, label %voiderr
 
@@ -118,7 +118,7 @@ after_check:                                      ; preds = %entry
 
 voiderr:                                          ; preds = %after_check, %entry
   %20 = load i8*, i8** %s, align 8
-  %21 = call { i8*, i64 } @std_core_string_String_str(i8* %20)
+  %21 = call { i8*, i64 } @std_core_string_VarString_str(i8* %20)
   %22 = bitcast %"char[]"* %result to { i8*, i64 }*
   store { i8*, i64 } %21, { i8*, i64 }* %22, align 8
   %23 = bitcast %"char[]"* %result to { i8*, i64 }*
diff --git a/test/test_suite2/contracts/ct_eval_of_ensure.c3 b/test/test_suite2/contracts/ct_eval_of_ensure.c3
index 1d53e2992..7c8209999 100644
--- a/test/test_suite2/contracts/ct_eval_of_ensure.c3
+++ b/test/test_suite2/contracts/ct_eval_of_ensure.c3
@@ -8,7 +8,7 @@ fn int test(int baz)
 }
 
 extern fn void printf(char*, ...);
-fn void main(char[][] args)
+fn void main(String[] args)
 {
    test(1022);
    printf("Hello\n");
diff --git a/test/test_suite2/define/test_at.c3 b/test/test_suite2/define/test_at.c3
index 520e9c591..a48b1bb20 100644
--- a/test/test_suite2/define/test_at.c3
+++ b/test/test_suite2/define/test_at.c3
@@ -12,6 +12,6 @@ import private foo;
 define intHello = foo::@hello<int>; // #error: cannot be aliased
 define @intHello = foo::hello<int>; // #error: cannot use
 
-fn void main(char[][] args) {
+fn void main(String[] args) {
     @intHello(42);
 }
\ No newline at end of file
diff --git a/test/test_suite2/define/test_at_alias.c3 b/test/test_suite2/define/test_at_alias.c3
index f0414ff44..f453dc948 100644
--- a/test/test_suite2/define/test_at_alias.c3
+++ b/test/test_suite2/define/test_at_alias.c3
@@ -11,6 +11,6 @@ import private foo;
 
 define @intHello = foo::@hello<int>;
 
-fn void main(char[][] args) {
+fn void main(String[] args) {
     @intHello(42);
 }
\ No newline at end of file
diff --git a/test/test_suite2/globals/global_init.c3 b/test/test_suite2/globals/global_init.c3
index b3cd2bd2c..eec62d316 100644
--- a/test/test_suite2/globals/global_init.c3
+++ b/test/test_suite2/globals/global_init.c3
@@ -1,6 +1,6 @@
 // TODO string str = "hello";
 char* str2 = "hello";
-char[] str3 = "hello";
+String str3 = "hello";
 
 
 int[2] a1 = { 1, 2 };
diff --git a/test/test_suite2/initializer_lists/disallowed_lists.c3 b/test/test_suite2/initializer_lists/disallowed_lists.c3
index abfcb2617..6f2225099 100644
--- a/test/test_suite2/initializer_lists/disallowed_lists.c3
+++ b/test/test_suite2/initializer_lists/disallowed_lists.c3
@@ -1,7 +1,7 @@
 fn void test()
 {
     char* hello = "123";
-    char[] a = { '1', '2', '3' };
+    String a = { '1', '2', '3' };
     char[*] b = { '1', '2', '3' };
     char[3] c = { '1', '2', '3' };
     char* d = { '1', '2', '3' }; // #error: Pointers cannot be initialized using an initializer list, instead you need to take the address of an array
diff --git a/test/test_suite2/methods/extension_method_generic.c3 b/test/test_suite2/methods/extension_method_generic.c3
index ab13e4eb1..35c460999 100644
--- a/test/test_suite2/methods/extension_method_generic.c3
+++ b/test/test_suite2/methods/extension_method_generic.c3
@@ -10,7 +10,7 @@ fn void IntArray.someFunc(IntArray *this, usz param) {
     this.push((int)param);
 }
 
-fn int main(char[][] argv)
+fn int main(String[] argv)
 {
     IntArray stk;
     stk.someFunc(256);
diff --git a/test/test_suite2/stdlib/map.c3t b/test/test_suite2/stdlib/map.c3t
index 55c0e3a2b..956177cb9 100644
--- a/test/test_suite2/stdlib/map.c3t
+++ b/test/test_suite2/stdlib/map.c3t
@@ -11,7 +11,7 @@ define IntDoubleMap = std::map::HashMap<int, double>;
 
 fn char[] Foo.to_string(Foo* foo, Allocator* allocator = mem::current_allocator())
 {
-	String s = string::new_with_capacity(128, allocator);
+	VarString s = string::new_with_capacity(128, allocator);
 	s.printf("{%s, %p}", foo.x, foo.bar);
 	return s.str();
 }
@@ -91,7 +91,7 @@ entry:
   %9 = insertvalue %variant %8, i64 ptrtoint (ptr @"ct$p$void" to i64), 1
   %10 = getelementptr inbounds [2 x %variant], ptr %varargslots, i64 0, i64 1
   store %variant %9, ptr %10, align 16
-  %11 = call i64 @std_core_string_String_printf(ptr %retparam, ptr %s, ptr @.str.12, i64 8, ptr %varargslots, i64 2)
+  %11 = call i64 @std_core_string_VarString_printf(ptr %retparam, ptr %s, ptr @.str.12, i64 8, ptr %varargslots, i64 2)
   %not_err = icmp eq i64 %11, 0
   br i1 %not_err, label %after_check, label %voiderr
 
@@ -100,7 +100,7 @@ after_check:                                      ; preds = %entry
 
 voiderr:                                          ; preds = %after_check, %entry
   %12 = load ptr, ptr %s, align 8
-  %13 = call { ptr, i64 } @std_core_string_String_str(ptr %12)
+  %13 = call { ptr, i64 } @std_core_string_VarString_str(ptr %12)
   store { ptr, i64 } %13, ptr %result, align 8
   %14 = load { ptr, i64 }, ptr %result, align 8
   ret { ptr, i64 } %14
diff --git a/test/unit/stdlib/conv_tests.c3 b/test/unit/stdlib/conv_tests.c3
index 7fd916156..782e625be 100644
--- a/test/unit/stdlib/conv_tests.c3
+++ b/test/unit/stdlib/conv_tests.c3
@@ -1,7 +1,7 @@
 module conv_tests;
 import std::io;
 
-fn void! comparison_helper_32_to_8(Char32 c32, char[] expected_output)
+fn void! comparison_helper_32_to_8(Char32 c32, String expected_output)
 {
 	char[8] out;
 	usz len = conv::char32_to_utf8(c32, &out, 4)?;
@@ -12,7 +12,7 @@ fn void! comparison_helper_32_to_8(Char32 c32, char[] expected_output)
 	}
 }
 
-fn void! comparison_helper_8_to_32(char[] in, Char32 c32)
+fn void! comparison_helper_8_to_32(String in, Char32 c32)
 {
 	usz len = in.len;
 	Char32 res = conv::utf8_to_char32(in.ptr, &len)?;
@@ -20,7 +20,7 @@ fn void! comparison_helper_8_to_32(char[] in, Char32 c32)
 	assert(res == c32, "Expected character match.");
 }
 
-fn void assert_utf8_is_error(char[] in)
+fn void assert_utf8_is_error(String in)
 {
 	usz len = in.len;
 	assert(catch(conv::utf8_to_char32(in.ptr, &len)), "Expected error");
diff --git a/test/unit/stdlib/crypto/rc4.c3 b/test/unit/stdlib/crypto/rc4.c3
index 084ce816c..91a619960 100644
--- a/test/unit/stdlib/crypto/rc4.c3
+++ b/test/unit/stdlib/crypto/rc4.c3
@@ -6,7 +6,7 @@ fn void! rc_crypt() @test
 	Rc4 rc;
 	rc.init(&&x"63727970746969");
 	char[200] x;
-	char[] text = "The quick brown fox jumps over the lazy dog.";
+	String text = "The quick brown fox jumps over the lazy dog.";
 	rc.crypt(text, &x);
 	char[*] res = x"2ac2fecdd8fbb84638e3a4
 	                820eb205cc8e29c28b9d5d