From 43dc2d650c0ae52a55f9d297281d5d19256420a1 Mon Sep 17 00:00:00 2001 From: Christoffer Lerno Date: Sat, 7 Jan 2023 22:50:33 +0100 Subject: [PATCH] Use "String" consistently for "char[]" (#694) Use "String" consistently for "char[]". Fix win32 return value. --- lib/std/core/builtin.c3 | 12 +-- lib/std/core/conv.c3 | 12 +-- lib/std/core/str.c3 | 82 ++++++++++--------- lib/std/core/string.c3 | 82 +++++++++---------- lib/std/core/string_iterator.c3 | 2 +- lib/std/io/dir.c3 | 20 ++--- lib/std/io/io_file.c3 | 14 ++-- lib/std/io/io_fileinfo.c3 | 2 +- lib/std/io/io_formatter_private.c3 | 6 +- lib/std/io/io_printf.c3 | 36 ++++---- lib/std/io/os/getcwd.c3 | 6 +- lib/std/runtime.c3 | 6 +- resources/examples/base64.c3 | 4 +- resources/examples/binarydigits.c3 | 6 +- resources/examples/brainfk.c3 | 6 +- resources/examples/contextfree/boolerr.c3 | 28 +++---- resources/examples/contextfree/dynscope.c3 | 6 +- .../examples/contextfree/guess_number.c3 | 6 +- resources/examples/contextfree/multi.c3 | 2 +- resources/examples/fasta.c3 | 10 +-- resources/examples/hash.c3 | 2 +- resources/examples/hello_world_many.c3 | 2 +- resources/examples/levenshtein.c3 | 2 +- resources/examples/nbodies.c3 | 2 +- resources/examples/notworking/madlibs.c3 | 6 +- .../examples/notworking/toml_tokenizer_c2.c3 | 2 +- resources/examples/plus_minus.c3 | 12 +-- resources/examples/spectralnorm.c3 | 2 +- resources/testfragments/allocators_testing.c3 | 2 +- resources/testfragments/parsertest.c3 | 2 +- resources/testfragments/tmem.c3 | 16 ++-- resources/testproject/project.json | 1 - src/compiler/compiler.c | 1 + src/compiler/compiler_internal.h | 6 +- src/compiler/llvm_codegen.c | 4 +- src/compiler/llvm_codegen_module.c | 4 +- src/compiler/llvm_codegen_stmt.c | 4 +- src/compiler/llvm_codegen_type.c | 3 +- src/compiler/sema_casts.c | 2 +- src/compiler/sema_expr.c | 14 ++-- src/compiler/sema_internal.h | 1 + src/compiler/semantic_analyser.c | 20 ++++- src/compiler/symtab.c | 9 ++ src/compiler/types.c | 4 +- src/main.c | 2 +- src/version.h | 2 +- .../test_suite/contracts/ct_eval_of_ensure.c3 | 2 +- test/test_suite/define/test_at.c3 | 2 +- test/test_suite/define/test_at_alias.c3 | 2 +- test/test_suite/globals/global_init.c3 | 2 +- .../initializer_lists/disallowed_lists.c3 | 2 +- .../methods/extension_method_generic.c3 | 2 +- test/test_suite/stdlib/map.c3t | 6 +- .../contracts/ct_eval_of_ensure.c3 | 2 +- test/test_suite2/define/test_at.c3 | 2 +- test/test_suite2/define/test_at_alias.c3 | 2 +- test/test_suite2/globals/global_init.c3 | 2 +- .../initializer_lists/disallowed_lists.c3 | 2 +- .../methods/extension_method_generic.c3 | 2 +- test/test_suite2/stdlib/map.c3t | 6 +- test/unit/stdlib/conv_tests.c3 | 6 +- test/unit/stdlib/crypto/rc4.c3 | 2 +- 62 files changed, 273 insertions(+), 246 deletions(-) diff --git a/lib/std/core/builtin.c3 b/lib/std/core/builtin.c3 index f7179051e..d1e60fe8e 100644 --- a/lib/std/core/builtin.c3 +++ b/lib/std/core/builtin.c3 @@ -56,12 +56,12 @@ macro varcast(variant v, $Type) @builtin struct CallstackElement { CallstackElement* prev; - char[] function; - char[] file; + String function; + String file; uint line; } -fn void default_panic(char[] message, char[] file, char[] function, uint line) +fn void default_panic(String message, String file, String function, uint line) { CallstackElement* stack = $$stacktrace(); $if ($defined(libc::stderr) && $defined(libc::fprintf)): @@ -88,7 +88,7 @@ fn void default_panic(char[] message, char[] file, char[] function, uint line) $$trap(); } -define PanicFn = fn void(char[] message, char[] file, char[] function, uint line); +define PanicFn = fn void(String message, String file, String function, uint line); PanicFn panic = &default_panic; @@ -110,7 +110,7 @@ macro bitcast(expr, $Type) @builtin /** * @require $Type.kindof == TypeKind.ENUM `Only enums may be used` **/ -macro enum_by_name($Type, char[] enum_name) @builtin +macro enum_by_name($Type, String enum_name) @builtin { typeid x = $Type.typeid; foreach (i, name : x.names) @@ -164,4 +164,4 @@ macro uint long.hash(long i) = (uint)((i >> 32) ^ i); macro uint ulong.hash(ulong i) = (uint)((i >> 32) ^ i); macro uint bool.hash(bool b) = (uint)b; macro uint typeid.hash(typeid t) = (uint)(((uptr)t >> 32) ^ (uptr)t); -macro uint char[].hash(char[] c) = (uint)fnv32a::encode(c); \ No newline at end of file +macro uint String.hash(String c) = (uint)fnv32a::encode(c); \ No newline at end of file diff --git a/lib/std/core/conv.c3 b/lib/std/core/conv.c3 index 625334674..1612a553b 100644 --- a/lib/std/core/conv.c3 +++ b/lib/std/core/conv.c3 @@ -185,7 +185,7 @@ fn Char32! utf8_to_char32(char* ptr, usz* size) * @param utf8 `An UTF-8 encoded slice of bytes` * @return `the number of encoded code points` **/ -fn usz utf8_codepoints(char[] utf8) +fn usz utf8_codepoints(String utf8) { usz len = 0; foreach (char c : utf8) @@ -257,7 +257,7 @@ fn usz utf8len_for_utf16(Char16[] utf16) * @param utf8 `the utf8 data to calculate from` * @return `the length of the resulting UTF16 array` **/ -fn usz utf16len_for_utf8(char[] utf8) +fn usz utf16len_for_utf8(String utf8) { usz len = utf8.len; usz len16 = 0; @@ -297,7 +297,7 @@ fn usz utf16len_for_utf32(Char32[] utf32) * @param [out] utf8_buffer * @return `the number of bytes written.` **/ -fn usz! utf32to8(Char32[] utf32, char[] utf8_buffer) +fn usz! utf32to8(Char32[] utf32, String utf8_buffer) { usz len = utf8_buffer.len; char* ptr = utf8_buffer.ptr; @@ -317,7 +317,7 @@ fn usz! utf32to8(Char32[] utf32, char[] utf8_buffer) * @param [out] utf32_buffer * @return `the number of Char32s written.` **/ -fn usz! utf8to32(char[] utf8, Char32[] utf32_buffer) +fn usz! utf8to32(String utf8, Char32[] utf32_buffer) { usz len = utf8.len; Char32* ptr = utf32_buffer.ptr; @@ -361,7 +361,7 @@ fn void! utf16to8_unsafe(Char16[] utf16, char* utf8_buffer) * @param [in] utf8 `The UTF8 buffer containing the data to convert.` * @param [out] utf32_buffer `the (sufficiently large) buffer to hold the UTF8 data.` **/ -fn void! utf8to32_unsafe(char[] utf8, Char32* utf32_buffer) +fn void! utf8to32_unsafe(String utf8, Char32* utf32_buffer) { usz len = utf8.len; for (usz i = 0; i < len;) @@ -381,7 +381,7 @@ fn void! utf8to32_unsafe(char[] utf8, Char32* utf32_buffer) * @param [in] utf8 `The UTF8 buffer containing the data to convert.` * @param [out] utf16_buffer `the (sufficiently large) buffer to hold the UTF8 data.` **/ -fn void! utf8to16_unsafe(char[] utf8, Char16* utf16_buffer) +fn void! utf8to16_unsafe(String utf8, Char16* utf16_buffer) { usz len = utf8.len; for (usz i = 0; i < len;) diff --git a/lib/std/core/str.c3 b/lib/std/core/str.c3 index b34e0c9a6..6f20581a6 100644 --- a/lib/std/core/str.c3 +++ b/lib/std/core/str.c3 @@ -1,5 +1,7 @@ module std::core::str; + define ZString = distinct char*; +define String = char[]; define Char32 = uint; define Char16 = ushort; @@ -18,17 +20,17 @@ fault NumberConversion MALFORMED_INTEGER, INTEGER_OVERFLOW, } -fn String join(char[][] s, char[] joiner) +fn VarString join(String[] s, String joiner) { - if (!s.len) return (String)null; + if (!s.len) return (VarString)null; usz total_size = joiner.len * s.len; - foreach (char[]* &str : s) + foreach (String* &str : s) { total_size += str.len; } - String res = string::new_with_capacity(total_size); + VarString res = string::new_with_capacity(total_size); res.append(s[0]); - foreach (char[]* &str : s[1..]) + foreach (String* &str : s[1..]) { res.append(joiner); res.append(*str); @@ -36,7 +38,7 @@ fn String join(char[][] s, char[] joiner) return res; } -macro bool char_in_set(char c, char[] set) +macro bool char_in_set(char c, String set) { foreach (ch : set) { @@ -50,7 +52,7 @@ private macro char_is_space_tab(char c) return c == ' ' || c == '\t'; } -private macro to_integer($Type, char[] string) +private macro to_integer($Type, String string) { usz len = string.len; usz index = 0; @@ -121,19 +123,19 @@ private macro to_integer($Type, char[] string) return value; } -fn int128! to_int128(char[] string) = to_integer(int128, string); -fn long! to_long(char[] string) = to_integer(long, string); -fn int! to_int(char[] string) = to_integer(int, string); -fn short! to_short(char[] string) = to_integer(short, string); -fn ichar! to_ichar(char[] string) = to_integer(ichar, string); +fn int128! to_int128(String string) = to_integer(int128, string); +fn long! to_long(String string) = to_integer(long, string); +fn int! to_int(String string) = to_integer(int, string); +fn short! to_short(String string) = to_integer(short, string); +fn ichar! to_ichar(String string) = to_integer(ichar, string); -fn uint128! to_uint128(char[] str) = to_integer(uint128, str); -fn ulong! to_ulong(char[] str) = to_integer(ulong, str); -fn uint! to_uint(char[] str) = to_integer(uint, str); -fn ushort! to_ushort(char[] str) = to_integer(ushort, str); -fn char! to_uchar(char[] str) = to_integer(char, str); +fn uint128! to_uint128(String str) = to_integer(uint128, str); +fn ulong! to_ulong(String str) = to_integer(ulong, str); +fn uint! to_uint(String str) = to_integer(uint, str); +fn ushort! to_ushort(String str) = to_integer(ushort, str); +fn char! to_uchar(String str) = to_integer(char, str); -fn char[] trim(char[] string, char[] to_trim = "\t\n\r ") +fn String trim(String string, String to_trim = "\t\n\r ") { usz start = 0; usz len = string.len; @@ -144,7 +146,7 @@ fn char[] trim(char[] string, char[] to_trim = "\t\n\r ") return string[start..end]; } -fn bool starts_with(char[] s, char[] needle) +fn bool starts_with(String s, String needle) { if (needle.len > s.len) return false; foreach (i, c : needle) @@ -154,17 +156,17 @@ fn bool starts_with(char[] s, char[] needle) return true; } -fn char[][] tsplit(char[] s, char[] needle) = split(s, needle, mem::temp_allocator()) @inline; +fn String[] tsplit(String s, String needle) = split(s, needle, mem::temp_allocator()) @inline; -fn char[][] split(char[] s, char[] needle, Allocator* allocator = mem::current_allocator()) +fn String[] split(String s, String needle, Allocator* allocator = mem::current_allocator()) { usz capacity = 16; usz i = 0; - char[]* holder = allocator.alloc(char[].sizeof * capacity)!!; + String* holder = allocator.alloc(String.sizeof * capacity)!!; while (s.len) { usz! index = index_of(s, needle); - char[] res = void; + String res = void; if (try index) { res = s[:index]; @@ -178,14 +180,14 @@ fn char[][] split(char[] s, char[] needle, Allocator* allocator = mem::current_a if (i == capacity) { capacity *= 2; - holder = allocator.realloc(holder, char[].sizeof * capacity)!!; + holder = allocator.realloc(holder, String.sizeof * capacity)!!; } holder[i++] = res; } return holder[:i]; } -fn usz! rindex_of(char[] s, char[] needle) +fn usz! rindex_of(String s, String needle) { usz match = 0; usz needed = needle.len; @@ -211,7 +213,7 @@ fn usz! rindex_of(char[] s, char[] needle) return SearchResult.MISSING!; } -fn usz! index_of(char[] s, char[] needle) +fn usz! index_of(String s, String needle) { usz match = 0; usz needed = needle.len; @@ -237,7 +239,7 @@ fn usz! index_of(char[] s, char[] needle) return SearchResult.MISSING!; } -fn ZString copy_zstring(char[] s, Allocator* allocator = mem::current_allocator()) +fn ZString copy_zstring(String s, Allocator* allocator = mem::current_allocator()) { usz len = s.len; char* str = allocator.alloc(len + 1)!!; @@ -246,7 +248,7 @@ fn ZString copy_zstring(char[] s, Allocator* allocator = mem::current_allocator( return (ZString)str; } -fn char[] copyz(char[] s, Allocator* allocator = mem::current_allocator()) +fn String copyz(String s, Allocator* allocator = mem::current_allocator()) { usz len = s.len; char* str = allocator.alloc(len + 1)!!; @@ -255,12 +257,12 @@ fn char[] copyz(char[] s, Allocator* allocator = mem::current_allocator()) return str[:len]; } -fn ZString tcopy_zstring(char[] s) +fn ZString tcopy_zstring(String s) { return copy_zstring(s, mem::temp_allocator()); } -fn bool compare(char[] a, char[] b) +fn bool compare(String a, String b) { if (a.len != b.len) return false; foreach (i, c : a) @@ -276,7 +278,7 @@ fault UnicodeResult CONVERSION_FAILED, } -fn usz utf8_codepoints(char[] utf8) +fn usz utf8_codepoints(String utf8) { usz len = 0; foreach (char c : utf8) @@ -286,7 +288,7 @@ fn usz utf8_codepoints(char[] utf8) return len; } -fn Char32[]! utf8to32(char[] utf8, Allocator* allocator = mem::current_allocator) +fn Char32[]! utf8to32(String utf8, Allocator* allocator = mem::current_allocator) { usz codepoints = conv::utf8_codepoints(utf8); Char32* data = allocator.alloc(Char32.sizeof * (codepoints + 1))?; @@ -295,7 +297,7 @@ fn Char32[]! utf8to32(char[] utf8, Allocator* allocator = mem::current_allocator return data[:codepoints]; } -fn char[] utf32to8(Char32[] utf32, Allocator* allocator = mem::current_allocator) +fn String utf32to8(Char32[] utf32, Allocator* allocator = mem::current_allocator) { usz len = conv::utf8len_for_utf32(utf32); char* data = allocator.alloc(len + 1)!!; @@ -304,7 +306,7 @@ fn char[] utf32to8(Char32[] utf32, Allocator* allocator = mem::current_allocator return data[:len]; } -fn Char16[]! utf8to16(char[] utf8, Allocator* allocator = mem::current_allocator) +fn Char16[]! utf8to16(String utf8, Allocator* allocator = mem::current_allocator) { usz len16 = conv::utf16len_for_utf8(utf8); Char16* data = allocator.alloc((len16 + 1) * Char16.sizeof)?; @@ -314,7 +316,7 @@ fn Char16[]! utf8to16(char[] utf8, Allocator* allocator = mem::current_allocator } -fn char[]! utf16to8(Char16[] utf16, Allocator* allocator = mem::current_allocator()) +fn String! utf16to8(Char16[] utf16, Allocator* allocator = mem::current_allocator()) { usz len = conv::utf8len_for_utf16(utf16); char* data = allocator.alloc(len + 1)?; @@ -322,21 +324,21 @@ fn char[]! utf16to8(Char16[] utf16, Allocator* allocator = mem::current_allocato return data[:len]; } -fn char[] copy(char[] s, Allocator* allocator = mem::current_allocator()) +fn String copy(String s, Allocator* allocator = mem::current_allocator()) { usz len = s.len; ZString str_copy = copy_zstring(s, allocator) @inline; return str_copy[:len]; } -fn char[] tcopy(char[] s) +fn String tcopy(String s) { usz len = s.len; ZString str_copy = tcopy_zstring(s) @inline; return str_copy[:len]; } -fn char[] tconcat(char[] s1, char[] s2) +fn String tconcat(String s1, String s2) { usz full_len = s1.len + s2.len; char* str = tmalloc(full_len + 1); @@ -347,7 +349,7 @@ fn char[] tconcat(char[] s1, char[] s2) return str[:full_len]; } -fn char[] concat(char[] s1, char[] s2) +fn String concat(String s1, String s2) { usz full_len = s1.len + s2.len; char* str = malloc(full_len + 1); @@ -358,7 +360,7 @@ fn char[] concat(char[] s1, char[] s2) return str[:full_len]; } -fn char[] ZString.as_str(ZString str) +fn String ZString.as_str(ZString str) { return ((char*)str)[:str.len()]; } diff --git a/lib/std/core/string.c3 b/lib/std/core/string.c3 index 060c8b64d..6c30199fb 100644 --- a/lib/std/core/string.c3 +++ b/lib/std/core/string.c3 @@ -1,7 +1,7 @@ module std::core::string; import libc; -define String = distinct void*; +define VarString = distinct void*; private struct StringData { @@ -13,30 +13,30 @@ private struct StringData const usz MIN_CAPACITY = 16; -fn String new_with_capacity(usz capacity, Allocator* allocator = mem::current_allocator()) +fn VarString new_with_capacity(usz capacity, Allocator* allocator = mem::current_allocator()) { if (capacity < MIN_CAPACITY) capacity = MIN_CAPACITY; StringData* data = allocator.alloc(StringData.sizeof + capacity)!!; data.allocator = allocator; data.len = 0; data.capacity = capacity; - return (String)data; + return (VarString)data; } -fn String new(char[] c) +fn VarString new(String c) { usz len = c.len; - String str = new_with_capacity(len); + VarString str = new_with_capacity(len); StringData* data = str.data(); if (len) { data.len = len; mem::copy(&data.chars, c.ptr, len); } - return (String)data; + return (VarString)data; } -fn ZString String.zstr(String str) +fn ZString VarString.zstr(VarString str) { StringData* data = str.data(); if (!data) return (ZString)""; @@ -52,7 +52,7 @@ fn ZString String.zstr(String str) return (ZString)&data.chars[0]; } -fn usz String.len(String this) +fn usz VarString.len(VarString this) { if (!this) return 0; return this.data().len; @@ -61,20 +61,20 @@ fn usz String.len(String this) /** * @require new_size <= this.len() */ -fn void String.chop(String this, usz new_size) +fn void VarString.chop(VarString this, usz new_size) { if (!this) return; this.data().len = new_size; } -fn char[] String.str(String str) +fn String VarString.str(VarString str) { StringData* data = (StringData*)str; - if (!data) return char[] {}; - return data.chars[:data.len]; + if (!data) return String {}; + return (String)data.chars[:data.len]; } -fn void String.append_utf32(String* str, Char32[] chars) +fn void VarString.append_utf32(VarString* str, Char32[] chars) { str.reserve(chars.len); foreach (Char32 c : chars) @@ -86,12 +86,12 @@ fn void String.append_utf32(String* str, Char32[] chars) /** * @require index < str.len() **/ -fn void String.set(String str, usz index, char c) +fn void VarString.set(VarString str, usz index, char c) { str.data().chars[index] = c; } -fn void String.append_repeat(String* str, char c, usz times) +fn void VarString.append_repeat(VarString* str, char c, usz times) { if (times == 0) return; str.reserve(times); @@ -105,7 +105,7 @@ fn void String.append_repeat(String* str, char c, usz times) /** * @require c < 0x10ffff */ -fn void String.append_char32(String* str, Char32 c) +fn void VarString.append_char32(VarString* str, Char32 c) { if (c < 0x7f) { @@ -139,23 +139,23 @@ fn void String.append_char32(String* str, Char32 c) data.chars[data.len++] = (char)(0x80 | (c & 0x3F)); } -fn String String.tcopy(String* str) = str.copy(mem::temp_allocator()); +fn VarString VarString.tcopy(VarString* str) = str.copy(mem::temp_allocator()); -fn String String.copy(String* str, Allocator* allocator = null) +fn VarString VarString.copy(VarString* str, Allocator* allocator = null) { if (!str) { if (allocator) return new_with_capacity(0, allocator); - return (String)null; + return (VarString)null; } if (!allocator) allocator = mem::current_allocator(); StringData* data = str.data(); - String new_string = new_with_capacity(data.capacity, allocator); + VarString new_string = new_with_capacity(data.capacity, allocator); mem::copy((char*)new_string.data(), (char*)data, StringData.sizeof + data.len); return new_string; } -fn ZString String.copy_zstr(String* str, Allocator* allocator = mem::current_allocator()) +fn ZString VarString.copy_zstr(VarString* str, Allocator* allocator = mem::current_allocator()) { usz str_len = str.len(); if (!str_len) @@ -169,14 +169,14 @@ fn ZString String.copy_zstr(String* str, Allocator* allocator = mem::current_all return (ZString)zstr; } -fn char[] String.copy_str(String* str, Allocator* allocator = mem::current_allocator()) +fn String VarString.copy_str(VarString* str, Allocator* allocator = mem::current_allocator()) { - return str.copy_zstr(allocator)[:str.len()]; + return (String)str.copy_zstr(allocator)[:str.len()]; } -fn char[] String.tcopy_str(String* str) = str.copy_str(mem::temp_allocator()) @inline; +fn String VarString.tcopy_str(VarString* str) = str.copy_str(mem::temp_allocator()) @inline; -fn bool String.equals(String str, String other_string) +fn bool VarString.equals(VarString str, VarString other_string) { StringData *str1 = str.data(); StringData *str2 = other_string.data(); @@ -192,16 +192,16 @@ fn bool String.equals(String str, String other_string) return true; } -fn void String.destroy(String* str) +fn void VarString.destroy(VarString* str) { if (!*str) return; StringData* data = str.data(); if (!data) return; data.allocator.free(data)!!; - *str = (String)null; + *str = (VarString)null; } -fn bool String.less(String str, String other_string) +fn bool VarString.less(VarString str, VarString other_string) { StringData* str1 = str.data(); StringData* str2 = other_string.data(); @@ -218,7 +218,7 @@ fn bool String.less(String str, String other_string) return true; } -fn void String.append_chars(String* this, char[] str) +fn void VarString.append_chars(VarString* this, String str) { usz other_len = str.len; if (!other_len) return; @@ -233,19 +233,19 @@ fn void String.append_chars(String* this, char[] str) data.len += other_len; } -fn Char32[] String.copy_utf32(String* this, Allocator* allocator = mem::current_allocator()) +fn Char32[] VarString.copy_utf32(VarString* this, Allocator* allocator = mem::current_allocator()) { return str::utf8to32(this.str(), allocator) @inline!!; } -fn void String.append_string(String* this, String str) +fn void VarString.append_string(VarString* this, VarString str) { StringData* other = (StringData*)str; if (!other) return; this.append(str.str()); } -fn void String.append_char(String* str, char c) +fn void VarString.append_char(VarString* str, char c) { if (!*str) { @@ -257,23 +257,23 @@ fn void String.append_char(String* str, char c) } -macro void String.append(String* str, value) +macro void VarString.append(VarString* str, value) { var $Type = $typeof(value); $switch ($Type): $case char: $case ichar: str.append_char(value); - $case String: + $case VarString: str.append_string(value); - $case char[]: + $case String: str.append_chars(value); $case Char32: str.append_char32(value); $default: $if (@convertible($Type, Char32)): str.append_char32(value); - $elif (@convertible($Type, char[])): + $elif (@convertible($Type, String)): str.append_chars(value); $else: $assert("Unsupported type for appending"); @@ -282,12 +282,12 @@ macro void String.append(String* str, value) } -private fn StringData* String.data(String str) @inline +private fn StringData* VarString.data(VarString str) @inline { return (StringData*)str; } -private fn void String.reserve(String* str, usz addition) +private fn void VarString.reserve(VarString* str, usz addition) { StringData* data = str.data(); if (!data) @@ -299,12 +299,12 @@ private fn void String.reserve(String* str, usz addition) if (data.capacity >= len) return; usz new_capacity = data.capacity *= 2; if (new_capacity < MIN_CAPACITY) new_capacity = MIN_CAPACITY; - *str = (String)data.allocator.realloc(data, StringData.sizeof + new_capacity)!!; + *str = (VarString)data.allocator.realloc(data, StringData.sizeof + new_capacity)!!; } -fn String String.new_concat(String a, String b, Allocator* allocator = mem::current_allocator()) +fn VarString VarString.new_concat(VarString a, VarString b, Allocator* allocator = mem::current_allocator()) { - String string = new_with_capacity(a.len() + b.len(), allocator); + VarString string = new_with_capacity(a.len() + b.len(), allocator); string.append(a); string.append(b); return string; diff --git a/lib/std/core/string_iterator.c3 b/lib/std/core/string_iterator.c3 index 51a9e662c..f2df2ac42 100644 --- a/lib/std/core/string_iterator.c3 +++ b/lib/std/core/string_iterator.c3 @@ -2,7 +2,7 @@ module std::core::string::iterator; struct StringIterator { - char[] utf8; + String utf8; usz current; } diff --git a/lib/std/io/dir.c3 b/lib/std/io/dir.c3 index c75fb0a94..b3a9f1dfa 100644 --- a/lib/std/io/dir.c3 +++ b/lib/std/io/dir.c3 @@ -1,7 +1,7 @@ module std::io::dir; import std::io::os; // In progress. -define Path = distinct char[]; +define Path = distinct String; const PREFERRED_SEPARATOR = USE_WIN32_FILESYSTEM ? '\\' : '/'; private const USE_WIN32_FILESYSTEM = env::OS_TYPE != OsType.WIN32; @@ -11,12 +11,12 @@ fault PathResult INVALID_PATH } -fn char[]! getcwd(Allocator* allocator = mem::default_allocator()) +fn String! getcwd(Allocator* allocator = mem::default_allocator()) { return os::getcwd(allocator); } -fn char[]! tgetcwd() +fn String! tgetcwd() { return getcwd(mem::temp_allocator()) @inline; } @@ -56,7 +56,7 @@ $else: $endif; } -private fn usz! root_name_len(char[] path) +private fn usz! root_name_len(String path) { usz len = path.len; if (!len) return 0; @@ -83,9 +83,9 @@ private fn usz! root_name_len(char[] path) return 0; } -private fn void! normalize_path(char[]* path_ref) +private fn void! normalize_path(String* path_ref) { - char[] path = *path_ref; + String path = *path_ref; if (!path.len) return; usz path_start = root_name_len(path)?; usz len = path_start; @@ -137,16 +137,16 @@ private fn void! normalize_path(char[]* path_ref) *path_ref = path[:len]; } -fn Path new_path(char[] path) +fn Path new_path(String path) { - char[] copy = str::copy(path); + String copy = str::copy(path); normalize_path(©)!!; return (Path)copy; } fn Path Path.root_name(Path path) { - char[] path_str = (char[])path; + String path_str = (String)path; usz len = root_name_len(path_str)!!; if (!len) return (Path)""; return (Path)path_str[0:len]; @@ -154,7 +154,7 @@ fn Path Path.root_name(Path path) fn Path Path.root_directory(Path path) { - char[] path_str = (char[])path; + String path_str = (String)path; usz len = path_str.len; if (!len) return (Path)""; $if (USE_WIN32_FILESYSTEM): diff --git a/lib/std/io/io_file.c3 b/lib/std/io/io_file.c3 index 0390404e1..a2141e5fe 100644 --- a/lib/std/io/io_file.c3 +++ b/lib/std/io/io_file.c3 @@ -1,7 +1,7 @@ module std::io; import libc; -fn void! File.open(File* file, char[] filename, char[] mode) +fn void! File.open(File* file, String filename, String mode) { @pool() { @@ -102,7 +102,7 @@ fn usz File.write(File* file, void* buffer, usz items, usz element_size = 1) * @param [&in] file * @require file.file `File must be initialized` */ -fn usz! File.println(File* file, char[] string) +fn usz! File.println(File* file, String string) { usz len = string.len; if (len != libc::fwrite(string.ptr, 1, len, file.file)) return IoError.UNKNOWN_ERROR!; @@ -114,9 +114,9 @@ fn usz! File.println(File* file, char[] string) * @param [&in] file * @require file.file `File must be initialized` */ -fn String File.getline(File* file, Allocator* allocator = mem::current_allocator()) +fn VarString File.getline(File* file, Allocator* allocator = mem::current_allocator()) { - String s = string::new_with_capacity(120, allocator); + VarString s = string::new_with_capacity(120, allocator); while (!file.eof()) { int c = libc::fgetc(file.file); @@ -130,12 +130,12 @@ fn String File.getline(File* file, Allocator* allocator = mem::current_allocator /** * @param [&in] file * @require file.file `File must be initialized` - * @return "a zero terminated char[] (the pointer may be safely cast into a ZString)" + * @return "a zero terminated String (the pointer may be safely cast into a ZString)" */ -fn char[] File.tgetline(File* file) +fn String File.tgetline(File* file) { - String s = file.getline(mem::temp_allocator()); + VarString s = file.getline(mem::temp_allocator()); ZString z = s.zstr(); return z[:s.len()]; } diff --git a/lib/std/io/io_fileinfo.c3 b/lib/std/io/io_fileinfo.c3 index 644eeaf7a..7bfcca28e 100644 --- a/lib/std/io/io_fileinfo.c3 +++ b/lib/std/io/io_fileinfo.c3 @@ -43,7 +43,7 @@ fn void! FileInfo.read(FileInfo* info, Path path) @pool() { Darwin64Stat stat; - int res = _stat(str::tcopy_zstring((char[])path), &stat); + int res = _stat(str::tcopy_zstring((String)path), &stat); if (res != 0) { switch (libc::errno()) diff --git a/lib/std/io/io_formatter_private.c3 b/lib/std/io/io_formatter_private.c3 index 68a6bcc0b..70961813c 100644 --- a/lib/std/io/io_formatter_private.c3 +++ b/lib/std/io/io_formatter_private.c3 @@ -131,7 +131,7 @@ private fn uint simple_atoi(char* buf, usz maxlen, usz* len_ptr) @inline } -private fn void! Formatter.out_substr(Formatter *this, char[] str) +private fn void! Formatter.out_substr(Formatter *this, String str) { usz l = conv::utf8_codepoints(str); uint prec = this.prec; @@ -415,7 +415,7 @@ private fn void! Formatter.ntoa(Formatter* this, uint128 value, bool negative, u return this.ntoa_format(buf[:PRINTF_NTOA_BUFFER_SIZE], len, negative, base); } -private fn void! Formatter.ntoa_format(Formatter* this, char[] buf, usz len, bool negative, uint base) +private fn void! Formatter.ntoa_format(Formatter* this, String buf, usz len, bool negative, uint base) { // pad leading zeros if (!this.flags.left) @@ -511,7 +511,7 @@ private fn void! Formatter.out_char(Formatter* this, variant arg) } -private fn void! Formatter.out_reverse(Formatter* this, char[] buf) +private fn void! Formatter.out_reverse(Formatter* this, String buf) { usz buffer_start_idx = this.idx; usz len = buf.len; diff --git a/lib/std/io/io_printf.c3 b/lib/std/io/io_printf.c3 index e86fd4038..3069cc964 100644 --- a/lib/std/io/io_printf.c3 +++ b/lib/std/io/io_printf.c3 @@ -17,7 +17,7 @@ fault PrintFault define OutputFn = fn void!(char c, void* buffer); -define ToStringFunction = fn char[](void* value, Allocator *allocator); +define ToStringFunction = fn String(void* value, Allocator *allocator); define ToFormatFunction = fn void!(void* value, Formatter* formatter); define FloatType = double; @@ -163,9 +163,9 @@ private fn void! Formatter.out_str(Formatter* this, variant arg) unreachable(); case DISTINCT: if (this.print_with_function(arg)?) return; - if (arg.type == String.typeid) + if (arg.type == VarString.typeid) { - return this.out_substr(((String*)arg).str()); + return this.out_substr(((VarString*)arg).str()); } return this.out_str(variant { arg.ptr, arg.type.inner }); case POINTER: @@ -188,7 +188,7 @@ private fn void! Formatter.out_str(Formatter* this, variant arg) typeid inner = arg.type.inner; usz size = inner.sizeof; usz len = arg.type.len; - // Pretend this is a char[] + // Pretend this is a String void* ptr = (void*)arg.ptr; this.out('[')?; for (usz i = 0; i < len; i++) @@ -204,7 +204,7 @@ private fn void! Formatter.out_str(Formatter* this, variant arg) typeid inner = arg.type.inner; usz size = inner.sizeof; usz len = arg.type.len; - // Pretend this is a char[] + // Pretend this is a String void* ptr = (void*)arg.ptr; this.out_substr("[<")?; for (usz i = 0; i < len; i++) @@ -220,11 +220,11 @@ private fn void! Formatter.out_str(Formatter* this, variant arg) typeid inner = arg.type.inner; if (inner == char.typeid) { - return this.out_substr(*(char[]*)arg); + return this.out_substr(*(String*)arg); } usz size = inner.sizeof; - // Pretend this is a char[] - char[]* temp = (void*)arg.ptr; + // Pretend this is a String + String* temp = (void*)arg.ptr; void* ptr = (void*)temp.ptr; usz len = temp.len; this.out('[')?; @@ -283,18 +283,18 @@ private fn void! out_fputchar_fn(char c, void* data) private fn void! out_string_append_fn(char c, void* data) { - String* s = data; + VarString* s = data; s.append_char(c); } -fn usz! printf(char[] format, args...) @maydiscard +fn usz! printf(String format, args...) @maydiscard { Formatter formatter; formatter.init(&out_putchar_fn); return formatter.vprintf(format, args); } -fn usz! printfln(char[] format, args...) @maydiscard +fn usz! printfln(String format, args...) @maydiscard { Formatter formatter; formatter.init(&out_putchar_fn); @@ -303,14 +303,14 @@ fn usz! printfln(char[] format, args...) @maydiscard return len + 1; } -fn usz! String.printf(String* str, char[] format, args...) @maydiscard +fn usz! VarString.printf(VarString* str, String format, args...) @maydiscard { Formatter formatter; formatter.init(&out_string_append_fn, str); return formatter.vprintf(format, args); } -fn usz! String.printfln(String* str, char[] format, args...) @maydiscard +fn usz! VarString.printfln(VarString* str, String format, args...) @maydiscard { Formatter formatter; formatter.init(&out_string_append_fn, str); @@ -325,7 +325,7 @@ private struct BufferData usz written; } -fn char[]! bprintf(char[] buffer, char[] format, args...) @maydiscard +fn char[]! bprintf(char[] buffer, String format, args...) @maydiscard { Formatter formatter; BufferData data = { .buffer = buffer }; @@ -334,14 +334,14 @@ fn char[]! bprintf(char[] buffer, char[] format, args...) @maydiscard return buffer[:size]; } -fn usz! File.printf(File file, char[] format, args...) @maydiscard +fn usz! File.printf(File file, String format, args...) @maydiscard { Formatter formatter; formatter.init(&out_putchar_fn, &file); return formatter.vprintf(format, args)?; } -fn usz! File.printfln(File file, char[] format, args...) @maydiscard +fn usz! File.printfln(File file, String format, args...) @maydiscard { Formatter formatter; formatter.init(&out_putchar_fn, &file); @@ -351,12 +351,12 @@ fn usz! File.printfln(File file, char[] format, args...) @maydiscard return len + 1; } -fn usz! Formatter.printf(Formatter* this, char[] format, args...) +fn usz! Formatter.printf(Formatter* this, String format, args...) { return this.vprintf(format, args) @inline; } -fn usz! Formatter.vprintf(Formatter* this, char[] format, variant[] variants) +fn usz! Formatter.vprintf(Formatter* this, String format, variant[] variants) { if (!this.out_fn) { diff --git a/lib/std/io/os/getcwd.c3 b/lib/std/io/os/getcwd.c3 index 6a38da8a4..fc53b7711 100644 --- a/lib/std/io/os/getcwd.c3 +++ b/lib/std/io/os/getcwd.c3 @@ -6,7 +6,7 @@ $if (env::OS_TYPE == OsType.WIN32): extern fn Char16* _wgetcwd(Char16* buffer, int maxlen); extern fn usz wcslen(Char16* str); -macro char[]! getcwd(Allocator* allocator = mem::default_allocator()) +macro String! getcwd(Allocator* allocator = mem::default_allocator()) { const DEFAULT_BUFFER = 256; Char16[DEFAULT_BUFFER] buffer; @@ -26,7 +26,7 @@ macro char[]! getcwd(Allocator* allocator = mem::default_allocator()) $else: extern fn ZString _getcwd(char* pwd, usz len) @extname("getcwd"); -macro char[]! getcwd(Allocator* allocator = mem::default_allocator()) +macro String! getcwd(Allocator* allocator = mem::default_allocator()) { const usz DEFAULT_BUFFER = 256; char[DEFAULT_BUFFER] buffer; @@ -40,7 +40,7 @@ macro char[]! getcwd(Allocator* allocator = mem::default_allocator()) free = true; } defer if (free) libc::free((void*)res); - char[] copy = str::copyz(res.as_str(), allocator); + String copy = str::copyz(res.as_str(), allocator); return copy; } diff --git a/lib/std/runtime.c3 b/lib/std/runtime.c3 index 6283aee49..0b18d940f 100644 --- a/lib/std/runtime.c3 +++ b/lib/std/runtime.c3 @@ -32,7 +32,7 @@ define TestFn = fn void!(); struct TestRunner { - char[][] test_names; + String[] test_names; TestFn[] test_fns; JmpBuf buf; } @@ -48,7 +48,7 @@ fn TestRunner test_runner_create() import libc; private TestRunner* current_runner; -fn void test_panic(char[] message, char[] file, char[] function, uint line) +fn void test_panic(String message, String file, String function, uint line) { io::println("[error]"); io::printfln("\n Error: %s", message); @@ -65,7 +65,7 @@ fn bool TestRunner.run(TestRunner* runner) int tests_passed = 0; int tests = runner.test_names.len; io::println("----- TESTS -----"); - foreach(i, char[] name : runner.test_names) + foreach(i, String name : runner.test_names) { io::printf("Testing %s ... ", name); if (libc::setjmp(&runner.buf) == 0) diff --git a/resources/examples/base64.c3 b/resources/examples/base64.c3 index ce70cf12a..6bd7ca1f9 100644 --- a/resources/examples/base64.c3 +++ b/resources/examples/base64.c3 @@ -42,7 +42,7 @@ const char PAD = '='; const char FIRST = '+'; const char LAST = 'z'; -fn void encode(char[] in, char *out) +fn void encode(String in, char *out) { int j = 0; char c = LUT_ENC[1]; @@ -76,7 +76,7 @@ fn void encode(char[] in, char *out) } -fn int! decode(char[] in, char* out, int* invalid_char_index = null) +fn int! decode(String in, char* out, int* invalid_char_index = null) { int j = 0; diff --git a/resources/examples/binarydigits.c3 b/resources/examples/binarydigits.c3 index 19bdbb485..e5a77423f 100644 --- a/resources/examples/binarydigits.c3 +++ b/resources/examples/binarydigits.c3 @@ -5,16 +5,16 @@ fn void main() { for (int i = 0; i < 20; i++) { - String s = bin(i); + VarString s = bin(i); defer s.destroy(); io::printf("%s\n", s); } } -fn String bin(int x) +fn VarString bin(int x) { int bits = 1 + (int)(x == 0 ? 0 : math::log10((double)(x)) / math::log10(2)); - String str; + VarString str; str.append_repeat('0', bits); for (int i = 0; i < bits; i++) { diff --git a/resources/examples/brainfk.c3 b/resources/examples/brainfk.c3 index 7781575a1..99d5e2cae 100644 --- a/resources/examples/brainfk.c3 +++ b/resources/examples/brainfk.c3 @@ -10,13 +10,13 @@ fault InterpretError INTEPRET_FAILED } -fn void! print_error(usz pos, char[] err) +fn void! print_error(usz pos, String err) { io::printfln("Error at %s: %s", pos, err); return InterpretError.INTEPRET_FAILED!; } -fn void! brainf(char[] program) +fn void! brainf(String program) { usz sp = 0; usz mem = 0; @@ -76,7 +76,7 @@ fn void! brainf(char[] program) } fn void! main() { - char[] program = ` + String program = ` ++++[>+++++<-]>[<+++++>-]+<+[ >[>+>+<<-]++>>[<<+>>-]>>>[-]++>[-]+ >>>+[[-]++++++>>>]<<<[[<++++++++<++>>-]+<.<[>----<-]<] diff --git a/resources/examples/contextfree/boolerr.c3 b/resources/examples/contextfree/boolerr.c3 index dd32f78bc..7a0a35888 100644 --- a/resources/examples/contextfree/boolerr.c3 +++ b/resources/examples/contextfree/boolerr.c3 @@ -3,11 +3,11 @@ import libc; import std::io; struct Doc { Head *head; } -struct Head { String* title; } +struct Head { VarString* title; } struct Summary { - String* title; + VarString* title; bool ok; } @@ -21,11 +21,11 @@ private struct StringData fn void Summary.print(Summary *s, File out) { - char[] title = s.title ? s.title.str() : "missing"; + String title = s.title ? s.title.str() : "missing"; out.printf("Summary({ .title = %s, .ok = %s})", title, s.ok); } -fn bool contains(char[] haystack, char[] needle) +fn bool contains(String haystack, String needle) { usz len = haystack.len; usz needle_len = needle.len; @@ -54,13 +54,13 @@ fault ReadError BAD_READ, } -fn Doc! readDoc(char[] url) +fn Doc! readDoc(String url) { if (contains(url, "fail")) return ReadError.BAD_READ!; if (contains(url, "head-missing")) return { .head = null }; if (contains(url, "title-missing")) return { @dupe(Head { .title = null }) }; - if (contains(url, "title-empty")) return { @dupe(Head { .title = @dupe((String)null) }) }; - String str; + if (contains(url, "title-empty")) return { @dupe(Head { .title = @dupe((VarString)null) }) }; + VarString str; str.printf("Title of %s", url); return { @dupe(Head { .title = @dupe(str) }) }; } @@ -73,7 +73,7 @@ fn Summary buildSummary(Doc doc) }; } -fn Summary readAndBuildSummary(char[] url) +fn Summary readAndBuildSummary(String url) { return buildSummary(readDoc(url)) ?? Summary { .title = null, .ok = false }; /* @@ -97,18 +97,18 @@ fault TitleResult fn bool! isTitleNonEmpty(Doc doc) { if (!doc.head) return TitleResult.TITLE_MISSING!; - String* head = doc.head.title; + VarString* head = doc.head.title; if (!head) return TitleResult.TITLE_MISSING!; return head.len() > 0; } -fn bool! readWhetherTitleNonEmpty(char[] url) +fn bool! readWhetherTitleNonEmpty(String url) { return isTitleNonEmpty(readDoc(url)); } -fn char[] bool_to_string(bool b) +fn String bool_to_string(bool b) { return b ? "true" : "false"; } @@ -116,10 +116,10 @@ fn char[] bool_to_string(bool b) fn void main() { - const char[][] URLS = { "good", "title-empty", "title-missing", "head-missing", "fail" }; + const String[] URLS = { "good", "title-empty", "title-missing", "head-missing", "fail" }; DynamicArenaAllocator dynamic_arena; dynamic_arena.init(1024); - foreach (char[] url : URLS) + foreach (String url : URLS) { mem::@scoped(&dynamic_arena) { @@ -128,7 +128,7 @@ fn void main() io::printf(" Summary: "); summary.print(io::stdout()); io::println(""); - char[] title_sure = summary.title ? summary.title.str() : ""; + String title_sure = summary.title ? summary.title.str() : ""; io::printf(" Title: %s\n", title_sure); bool! has_title = readWhetherTitleNonEmpty(url); // This looks a bit less than elegant, but as you see it's mostly due to having to diff --git a/resources/examples/contextfree/dynscope.c3 b/resources/examples/contextfree/dynscope.c3 index f5ce2174e..387018a5c 100644 --- a/resources/examples/contextfree/dynscope.c3 +++ b/resources/examples/contextfree/dynscope.c3 @@ -1,7 +1,7 @@ module foo; import std::io; -tlocal char[] context_user = "safe"; +tlocal String context_user = "safe"; macro long reallyPerform(task) { @@ -14,7 +14,7 @@ macro long perform(task) return reallyPerform(task); } -macro @with_mode(char[] user, #action, ...) +macro @with_mode(String user, #action, ...) { @scope(context_user) { @@ -27,6 +27,6 @@ fn void main() { long val1 = perform("something"); long val2 = @with_mode("faster", perform, "reliable"); - long val3 = perform(char[][] {"something"}); + long val3 = perform(String[] {"something"}); io::printfln("%d %d %d", val1, val2, val3); } diff --git a/resources/examples/contextfree/guess_number.c3 b/resources/examples/contextfree/guess_number.c3 index 576bacc12..1ba110b94 100644 --- a/resources/examples/contextfree/guess_number.c3 +++ b/resources/examples/contextfree/guess_number.c3 @@ -23,14 +23,14 @@ int err_count = 0; fn int! askGuess(int high) { libc::printf("Guess a number between 1 and %d: ", high); - char[] text = readLine()?; + String text = readLine()?; char* end = null; int value = (int)libc::strtol(text.ptr, &end, 10); if (end && end[0] >= ' ') return InputResult.NOT_AN_INT!; return value; } -fn char[]! readLine() +fn String! readLine() { char* chars = tmalloc(1024)?; isz loaded = getline(&chars, &&(usz)1023, libc::stdin()); @@ -67,7 +67,7 @@ fn void! Game.play(Game *game) fn void Game.report(Game *game, int guess) { - char[] desc = {| + String desc = {| if (guess < game.answer) return "too low"; if (guess > game.answer) return "too high"; return "the answer"; diff --git a/resources/examples/contextfree/multi.c3 b/resources/examples/contextfree/multi.c3 index 002556270..6071a1d2b 100644 --- a/resources/examples/contextfree/multi.c3 +++ b/resources/examples/contextfree/multi.c3 @@ -9,7 +9,7 @@ fn void main() And a nested comment. */ */ - char[] text = ` + String text = ` function hello() { console.log("name`"\t"`age"); } diff --git a/resources/examples/fasta.c3 b/resources/examples/fasta.c3 index 4faba77f7..8069a93d2 100644 --- a/resources/examples/fasta.c3 +++ b/resources/examples/fasta.c3 @@ -15,7 +15,7 @@ fn float fasta_rand(float max_val) return max_val * seed / IM; } -private char[] alu = +private String alu = "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" @@ -25,7 +25,7 @@ private char[] alu = "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; -char[] iub = "acgtBDHKMNRSVWY"; +String iub = "acgtBDHKMNRSVWY"; double[] iub_p = { 0.27, 0.12, @@ -43,7 +43,7 @@ double[] iub_p = { 0.02, 0.02 }; -char[] homosapiens = "acgt"; +String homosapiens = "acgt"; double[] homosapiens_p = { 0.3029549426680, 0.1979883004921, @@ -54,7 +54,7 @@ double[] homosapiens_p = { const LINELEN = 60; // slowest character-at-a-time output -fn void repeat_fasta(char[] seq, int n) +fn void repeat_fasta(String seq, int n) { usz len = seq.len; int i = void; @@ -66,7 +66,7 @@ fn void repeat_fasta(char[] seq, int n) if (i % LINELEN != 0) io::putchar('\n'); } -fn void random_fasta(char[] symb, double[] probability, int n) +fn void random_fasta(String symb, double[] probability, int n) { assert(symb.len == probability.len); int len = probability.len; diff --git a/resources/examples/hash.c3 b/resources/examples/hash.c3 index f20f09971..b8521b2f1 100644 --- a/resources/examples/hash.c3 +++ b/resources/examples/hash.c3 @@ -7,7 +7,7 @@ import libc; fn void main() { - char[] y = "Hello World!"; + String y = "Hello World!"; libc::printf("Adler32 of %s is %x, expected 1c49043e\n", (char*)(y), adler32(y)); libc::printf("CRC32B of %s is %x, expected 1c291ca3\n", (char*)(y), crc32(y)); libc::printf("CRC64 of %s is %llx, expected fad9a77c67077205\n", (char*)(y), crc64(y)); diff --git a/resources/examples/hello_world_many.c3 b/resources/examples/hello_world_many.c3 index b37edf2a8..3ceaadeb2 100644 --- a/resources/examples/hello_world_many.c3 +++ b/resources/examples/hello_world_many.c3 @@ -2,7 +2,7 @@ import std::io; fn void main() { - char[][] greetings = { + String[] greetings = { "Hello, world!", "¡Hola Mundo!", "Γειά σου Κόσμε!", diff --git a/resources/examples/levenshtein.c3 b/resources/examples/levenshtein.c3 index d7caa695f..7ee37e900 100644 --- a/resources/examples/levenshtein.c3 +++ b/resources/examples/levenshtein.c3 @@ -2,7 +2,7 @@ module levenshtein; import std::math; // This levenshtein exercises C3 subarrays. -fn int levenshtein(char[] s, char[] t) +fn int levenshtein(String s, String t) { // if either string is empty, difference is inserting all chars // from the other diff --git a/resources/examples/nbodies.c3 b/resources/examples/nbodies.c3 index c0a83d8e3..03fa1db48 100644 --- a/resources/examples/nbodies.c3 +++ b/resources/examples/nbodies.c3 @@ -142,7 +142,7 @@ fn void scale_bodies(Planet[] bodies, double scale) } -fn void main(char[][] args) +fn void main(String[] args) { int n = args.len < 2 ? 50000000 : str::to_int(args[1])!!; diff --git a/resources/examples/notworking/madlibs.c3 b/resources/examples/notworking/madlibs.c3 index 1a6dbe684..194d02e3c 100644 --- a/resources/examples/notworking/madlibs.c3 +++ b/resources/examples/notworking/madlibs.c3 @@ -4,10 +4,10 @@ import regex, stdio; fn void main() { println("Enter a story template, terminated by an empty line:"); - String story = ""; + VarString story = ""; while (1) { - String line = stdin.readln().strip() else break; + VarString line = stdin.readln().strip() else break; story = story.append(line); story = story.append("\n"); } @@ -19,7 +19,7 @@ fn void main() foreach (RegexMatch* match : r.match(story)) { - String s = match.string; + VarString s = match.string; printf("Enter a value for '%s': ", s[1..^2]); string word = stdin.readln().strip() else return; story = story.replace(s, word); diff --git a/resources/examples/notworking/toml_tokenizer_c2.c3 b/resources/examples/notworking/toml_tokenizer_c2.c3 index 9c28afa8c..663b53724 100644 --- a/resources/examples/notworking/toml_tokenizer_c2.c3 +++ b/resources/examples/notworking/toml_tokenizer_c2.c3 @@ -7,7 +7,7 @@ import stdlib; const uint MaxText = 1024; -enum TokenKind : char (String name) +enum TokenKind : char (VarString name) { WORD("word"), TEXT("text"), diff --git a/resources/examples/plus_minus.c3 b/resources/examples/plus_minus.c3 index 767ac5f7b..674f67818 100644 --- a/resources/examples/plus_minus.c3 +++ b/resources/examples/plus_minus.c3 @@ -10,15 +10,15 @@ fault TokenResult // While we could have written this with libc // the C way, let's showcase some features added to C3. -fn void main(char[][] args) +fn void main(String[] args) { // Grab a string from stdin - String s = io::stdin().getline(); + VarString s = io::stdin().getline(); // Delete it at scope end [defer] defer s.destroy(); // Grab the string as a slice. - char[] numbers = s.str(); + String numbers = s.str(); // Track our current value int val = 0; @@ -26,7 +26,7 @@ fn void main(char[][] args) // Is the current state an add? bool add = true; - while (try char[] token = read_next(&numbers)) + while (try String token = read_next(&numbers)) { // We're assuming well formed input here // so just use atoi. @@ -36,7 +36,7 @@ fn void main(char[][] args) val = add ? val + i : val - i; // Read an optional token. - char[]! op = read_next(&numbers); + String! op = read_next(&numbers); // If it's an error, then we're done. if (catch op) break; @@ -56,7 +56,7 @@ fn void main(char[][] args) io::printfln("%d", val); } -fn char[]! read_next(char[]* remaining) +fn String! read_next(String* remaining) { while (remaining.len > 0 && (*remaining)[0] == ' ') { diff --git a/resources/examples/spectralnorm.c3 b/resources/examples/spectralnorm.c3 index 95945c215..ebc6463f9 100644 --- a/resources/examples/spectralnorm.c3 +++ b/resources/examples/spectralnorm.c3 @@ -42,7 +42,7 @@ fn void eval_AtA_times_u(double[] u, double[] atau, double[] x) eval_At_times_u(temparr, atau, x); } -fn void main(char[][] args) +fn void main(String[] args) { int n = args.len == 2 ? str::to_int(args[1])!! : 2000; temparr = array::alloc(double, n); diff --git a/resources/testfragments/allocators_testing.c3 b/resources/testfragments/allocators_testing.c3 index f22a72dd9..b1f55d22a 100644 --- a/resources/testfragments/allocators_testing.c3 +++ b/resources/testfragments/allocators_testing.c3 @@ -12,7 +12,7 @@ fn void print_pages() mem::temp_allocator().print_pages(io::stdout()); } -fn void setstring(char* dst, char[] str) +fn void setstring(char* dst, String str) { foreach (char c : str) { diff --git a/resources/testfragments/parsertest.c3 b/resources/testfragments/parsertest.c3 index 7051223bf..545cf6ea7 100644 --- a/resources/testfragments/parsertest.c3 +++ b/resources/testfragments/parsertest.c3 @@ -143,7 +143,7 @@ $else generic boofer2(i, g, eok) { - case int, char[], type($eoo): + case int, String, type($eoo): return "Helo"; default: return 1000; diff --git a/resources/testfragments/tmem.c3 b/resources/testfragments/tmem.c3 index c5a44fe76..ace0ec9a8 100644 --- a/resources/testfragments/tmem.c3 +++ b/resources/testfragments/tmem.c3 @@ -2,7 +2,7 @@ module tmem; import std::mem; import std::io; -struct String +struct VarString { Allocator allocator; usz len; @@ -10,7 +10,7 @@ struct String char* ptr; } -fn void String.init(String *s, char[] c) +fn void VarString.init(VarString *s, String c) { s.capacity = c.len + 16; s.ptr = malloc(s.capacity); @@ -18,7 +18,7 @@ fn void String.init(String *s, char[] c) mem::copy(s.ptr, (char*)(c), c.len); } -fn char* String.zstr(String *s) +fn char* VarString.zstr(VarString *s) { char* c = malloc(s.len + 1); mem::copy(c, s.ptr, s.len); @@ -26,7 +26,7 @@ fn char* String.zstr(String *s) return c; } -fn void String.appendc(String *s, char c) +fn void VarString.appendc(VarString *s, char c) { if (s.capacity == s.len) { @@ -38,7 +38,7 @@ fn void String.appendc(String *s, char c) s.ptr[s.len++] = c; } -fn void String.append(String *s, char[] other_string) +fn void VarString.append(VarString *s, String other_string) { if (s.capacity < s.len + other_string.len) { @@ -55,7 +55,7 @@ fn void String.append(String *s, char[] other_string) s.len += other_string.len; } -fn void String.concat(String *s, String* other_string) +fn void VarString.concat(VarString *s, VarString* other_string) { if (s.capacity < s.len + other_string.len) { @@ -74,12 +74,12 @@ fn void String.concat(String *s, String* other_string) fn void main() { - String s; + VarString s; s.init("Hello"); s.appendc(' '); s.appendc('W'); s.append("orld!"); - String w; + VarString w; w.init("Yo man!"); s.concat(&w); libc::printf("Message was: %s\n", s.zstr()); diff --git a/resources/testproject/project.json b/resources/testproject/project.json index a8613401f..821bba493 100644 --- a/resources/testproject/project.json +++ b/resources/testproject/project.json @@ -27,7 +27,6 @@ "hello_world_win32": { "type": "executable", "c-sources-override": [ - "./csource/**" ] }, "hello_world_lib": { diff --git a/src/compiler/compiler.c b/src/compiler/compiler.c index d0822a910..c42bbda01 100644 --- a/src/compiler/compiler.c +++ b/src/compiler/compiler.c @@ -750,6 +750,7 @@ void compile() } global_context.sources = active_target.sources; global_context.main = NULL; + global_context.string_type = NULL; asm_target.initialized = false; target_setup(&active_target); resolve_libraries(); diff --git a/src/compiler/compiler_internal.h b/src/compiler/compiler_internal.h index e84d53b92..565f79f1d 100644 --- a/src/compiler/compiler_internal.h +++ b/src/compiler/compiler_internal.h @@ -1666,12 +1666,13 @@ typedef struct DeclTable symbols; DeclTable generic_symbols; Path std_module_path; + Type *string_type; Decl *panic_var; Decl *main; Decl *test_func; Decl *decl_stack[MAX_GLOBAL_DECL_STACK]; - Decl** decl_stack_bottom; - Decl** decl_stack_top; + Decl **decl_stack_bottom; + Decl **decl_stack_top; } GlobalContext; @@ -2259,6 +2260,7 @@ void decltable_set(DeclTable *table, Decl *decl); const char *scratch_buffer_interned(void); +const char *symtab_preset(const char *data, TokenType type); const char *symtab_add(const char *symbol, uint32_t len, uint32_t fnv1hash, TokenType *type); const char *symtab_find(const char *symbol, uint32_t len, uint32_t fnv1hash, TokenType *type); void *llvm_target_machine_create(void); diff --git a/src/compiler/llvm_codegen.c b/src/compiler/llvm_codegen.c index 9824e70d1..251cde58f 100644 --- a/src/compiler/llvm_codegen.c +++ b/src/compiler/llvm_codegen.c @@ -1065,10 +1065,10 @@ INLINE GenContext *llvm_gen_tests(Module** modules, unsigned module_count, LLVMC unsigned test_count = vec_size(decls); LLVMValueRef name_ref; LLVMValueRef decl_ref; - LLVMTypeRef chars_type = llvm_get_type(c, type_chars); + if (test_count) { - LLVMValueRef array_of_names = LLVMConstArray(chars_type, names, test_count); + LLVMValueRef array_of_names = LLVMConstArray(c->chars_type, names, test_count); LLVMValueRef array_of_decls = LLVMConstArray(LLVMPointerType(opt_test, 0), decls, test_count); LLVMTypeRef arr_type = LLVMTypeOf(array_of_names); name_ref = llvm_add_global_raw(c, ".test_names", arr_type, 0); diff --git a/src/compiler/llvm_codegen_module.c b/src/compiler/llvm_codegen_module.c index 3a4519646..446c3c973 100644 --- a/src/compiler/llvm_codegen_module.c +++ b/src/compiler/llvm_codegen_module.c @@ -27,7 +27,7 @@ static inline LLVMTypeRef create_fault_type(GenContext *c) { LLVMTypeRef type = LLVMStructCreateNamed(c->context, ".fault"); LLVMTypeRef typeid_type = llvm_get_type(c, type_typeid); - LLVMTypeRef chars_type = llvm_get_type(c, type_chars); + LLVMTypeRef chars_type = c->chars_type; LLVMTypeRef fault_type[] = { [0] = typeid_type, [1] = chars_type, @@ -123,11 +123,11 @@ void gencontext_begin_module(GenContext *c) } c->bool_type = LLVMInt1TypeInContext(c->context); c->byte_type = LLVMInt8TypeInContext(c->context); + c->chars_type = llvm_get_type(c, type_chars); c->introspect_type = create_introspection_type(c); c->fault_type = create_fault_type(c); c->size_type = llvm_get_type(c, type_usize); c->char_ptr_type = LLVMPointerType(c->byte_type, 0); - c->chars_type = llvm_get_type(c, type_chars); if (c->panic_var) c->panic_var->backend_ref = NULL; if (active_target.debug_info != DEBUG_INFO_NONE) diff --git a/src/compiler/llvm_codegen_stmt.c b/src/compiler/llvm_codegen_stmt.c index fc4309e75..441b23d97 100644 --- a/src/compiler/llvm_codegen_stmt.c +++ b/src/compiler/llvm_codegen_stmt.c @@ -1245,13 +1245,13 @@ LLVMValueRef llvm_emit_string_const(GenContext *c, const char *str, const char * if (!len) return llvm_emit_empty_string_const(c); LLVMValueRef val = llvm_emit_zstring_named(c, str, extname); LLVMValueRef data[2] = { val, llvm_const_int(c, type_usize, strlen(str)) }; - return llvm_get_struct_named(llvm_get_type(c, type_chars), data, 2); + return llvm_get_struct_named(c->chars_type, data, 2); } LLVMValueRef llvm_emit_empty_string_const(GenContext *c) { LLVMValueRef data[2] = { LLVMConstNull(c->char_ptr_type), llvm_const_int(c, type_usize, 0) }; - return llvm_get_struct_named(llvm_get_type(c, type_chars), data, 2); + return llvm_get_struct_named(c->chars_type, data, 2); } LLVMValueRef llvm_emit_zstring(GenContext *c, const char *str) diff --git a/src/compiler/llvm_codegen_type.c b/src/compiler/llvm_codegen_type.c index 76d88340d..c2160179e 100644 --- a/src/compiler/llvm_codegen_type.c +++ b/src/compiler/llvm_codegen_type.c @@ -556,7 +556,6 @@ static LLVMValueRef llvm_get_introspection_for_enum(GenContext *c, Type *type) if (!is_dynamic) is_external = false; - LLVMTypeRef subarray = llvm_get_type(c, type_chars); LLVMValueRef *values = elements ? malloc_arena(elements * sizeof(LLVMValueRef)) : NULL; bool obfuscate = decl->obfuscate; @@ -574,7 +573,7 @@ static LLVMValueRef llvm_get_introspection_for_enum(GenContext *c, Type *type) } values[i] = llvm_emit_string_const(c, name, scratch_buffer_to_string()); } - LLVMValueRef names = llvm_get_array(subarray, values, elements); + LLVMValueRef names = llvm_get_array(c->chars_type, values, elements); LLVMValueRef val = llvm_generate_introspection_global(c, NULL, type, INTROSPECT_TYPE_ENUM, type_flatten(type), elements, names, is_external); LLVMTypeRef val_type; diff --git a/src/compiler/sema_casts.c b/src/compiler/sema_casts.c index 96d415dcb..3697fc6d3 100644 --- a/src/compiler/sema_casts.c +++ b/src/compiler/sema_casts.c @@ -516,7 +516,7 @@ static bool cast_may_explicit(Type *from_type, Type *to_type, bool is_const) // Allow conversion float -> float/int/bool/enum return type_is_integer(to_type) || type_is_float(to_type) || to_type == type_bool || to_kind == TYPE_ENUM; case TYPE_POINTER: - UNREACHABLE + return type_is_pointer_sized_or_more(to_type) || to_type == type_bool; case TYPE_ANY: return to_kind == TYPE_POINTER; case TYPE_FAULTTYPE: diff --git a/src/compiler/sema_expr.c b/src/compiler/sema_expr.c index fff1a73fb..71f8b8df5 100644 --- a/src/compiler/sema_expr.c +++ b/src/compiler/sema_expr.c @@ -2736,7 +2736,7 @@ static inline void sema_expr_replace_with_enum_name_array(Expr *enum_array_expr, initializer->initializer_list = element_values; enum_array_expr->expr_kind = EXPR_COMPOUND_LITERAL; enum_array_expr->expr_compound_literal.initializer = initializer; - enum_array_expr->expr_compound_literal.type_info = type_info_new_base(type_get_subarray(type_chars), span); + enum_array_expr->expr_compound_literal.type_info = type_info_new_base(type_get_subarray(global_context_string_type()), span); enum_array_expr->resolve_status = RESOLVE_NOT_DONE; } @@ -3210,7 +3210,7 @@ static bool sema_expr_rewrite_to_typeid_property(SemaContext *context, Expr *exp sema_expr_rewrite_typeid_kind(expr, typeid); return true; case TYPE_PROPERTY_NAMES: - return sema_expr_rewrite_typeid_call(expr, typeid, TYPEID_INFO_NAMES, type_get_subarray(type_chars)); + return sema_expr_rewrite_typeid_call(expr, typeid, TYPEID_INFO_NAMES, type_get_subarray(global_context_string_type())); case TYPE_PROPERTY_ALIGNOF: case TYPE_PROPERTY_INF: case TYPE_PROPERTY_MIN: @@ -3516,7 +3516,7 @@ CHECK_DEEPER: } else { - expr_rewrite_to_builtin_access(expr, current_parent, ACCESS_ENUMNAME, type_chars); + expr_rewrite_to_builtin_access(expr, current_parent, ACCESS_ENUMNAME, global_context_string_type()); return true; } } @@ -3527,7 +3527,7 @@ CHECK_DEEPER: expr_rewrite_to_string(expr, current_parent->const_expr.enum_err_val->name); return true; } - expr_rewrite_to_builtin_access(expr, current_parent, ACCESS_FAULTNAME, type_chars); + expr_rewrite_to_builtin_access(expr, current_parent, ACCESS_FAULTNAME, global_context_string_type()); return true; } } @@ -6004,10 +6004,10 @@ static inline bool sema_expr_analyse_compiler_const(SemaContext *context, Expr * expr->expr_kind = EXPR_CONST; ConstInitializer *init = expr->const_expr.initializer = CALLOCS(ConstInitializer); init->kind = CONST_INIT_ZERO; - init->type = expr->type = type_get_subarray(type_chars); + init->type = expr->type = type_get_subarray(global_context_string_type()); return true; } - expr->type = type_get_subarray(type_chars); + expr->type = type_get_subarray(global_context_string_type()); expr->test_hook_expr = BUILTIN_DEF_TEST_NAMES; expr->expr_kind = EXPR_TEST_HOOK; return true; @@ -6802,7 +6802,7 @@ static inline bool sema_analyse_expr_dispatch(SemaContext *context, Expr *expr) if (!sema_expr_analyse_ct_stringify(context, expr)) return false; return true; case EXPR_ARGV_TO_SUBARRAY: - expr->type = type_get_subarray(type_chars); + expr->type = type_get_subarray(global_context_string_type()); return true; case EXPR_DECL: if (!sema_analyse_var_decl(context, expr->decl_expr, true)) return false; diff --git a/src/compiler/sema_internal.h b/src/compiler/sema_internal.h index cedb287ee..0dbf69e73 100644 --- a/src/compiler/sema_internal.h +++ b/src/compiler/sema_internal.h @@ -48,6 +48,7 @@ extern const char *ct_eval_error; Decl **global_context_acquire_locals_list(void); void generic_context_release_locals_list(Decl **); +Type *global_context_string_type(void); AstId context_get_defers(SemaContext *context, AstId defer_top, AstId defer_bottom); void context_pop_defers(SemaContext *context, AstId *next); diff --git a/src/compiler/semantic_analyser.c b/src/compiler/semantic_analyser.c index a28cd408b..49c771af0 100644 --- a/src/compiler/semantic_analyser.c +++ b/src/compiler/semantic_analyser.c @@ -224,6 +224,20 @@ static void sema_analyze_to_stage(AnalysisStage stage) halt_on_error(); } +Type *global_context_string_type(void) +{ + if (global_context.string_type) return global_context.string_type; + DeclId type = decltable_get(&global_context.symbols, symtab_preset("String", TOKEN_TYPE_IDENT)); + if (!type) error_exit("Missing definition of 'String' type."); + Decl *decl = declptr(type); + if (decl->decl_kind == DECL_TYPEDEF || decl->decl_kind == DECL_DISTINCT) + { + if (type_flatten(decl->type) == type_chars) return global_context.string_type = decl->type; + + } + error_exit("Invalid definition of String, expected a type with an underlying char[]"); +} + /** * Perform the entire semantic analysis. */ @@ -266,7 +280,6 @@ void sema_analysis_run(void) // Set a maximum of symbols in the std_module and test module htable_init(&global_context.std_module.symbols, 0x10000); - // Setup the func prototype hash map type_func_prototype_init(0x10000); @@ -312,9 +325,10 @@ void sema_analysis_run(void) { error_exit("'%s::%s' is not a function pointer.", path->module, ident); } - if (!type_func_match(panic_fn_type, type_void, 4, type_chars, type_chars, type_chars, type_uint)) + Type *string = global_context_string_type(); + if (!type_func_match(panic_fn_type, type_void, 4, string, string, string, type_uint)) { - error_exit("Expected panic function to have the signature fn void(char[], char[], char[], uint)."); + error_exit("Expected panic function to have the signature fn void(String, String, String, uint)."); } global_context.panic_var = decl; } diff --git a/src/compiler/symtab.c b/src/compiler/symtab.c index 04d45ce18..d08f697af 100644 --- a/src/compiler/symtab.c +++ b/src/compiler/symtab.c @@ -336,6 +336,15 @@ const char *symtab_find(const char *symbol, uint32_t len, uint32_t fnv1hash, Tok return NULL; } +const char *symtab_preset(const char *data, TokenType type) +{ + uint32_t len = (uint32_t)strlen(data); + TokenType result = type; + const char *res = symtab_add(data, len, fnv1a(data, len), &result); + assert(result == type); + return res; +} + const char *symtab_add(const char *data, uint32_t len, uint32_t fnv1hash, TokenType *type) { size_t pos = fnv1hash & symtab.bucket_mask; diff --git a/src/compiler/types.c b/src/compiler/types.c index 9be3cc780..0018fbe26 100644 --- a/src/compiler/types.c +++ b/src/compiler/types.c @@ -8,9 +8,9 @@ static Type *flatten_raw_function_type(Type *type); static struct { - Type u0, u1, i8, i16, i32, i64, i128, ixx; + Type u0, u1, i8, i16, i32, i64, i128; Type u8, u16, u32, u64, u128; - Type f16, f32, f64, f128, fxx; + Type f16, f32, f64, f128; Type usz, isz, usize, isize, uptr, iptr; Type voidstar, typeid, anyerr, member, typeinfo, untyped_list; Type any, anyfail; diff --git a/src/main.c b/src/main.c index 83c09fe3b..ee7317e49 100644 --- a/src/main.c +++ b/src/main.c @@ -99,7 +99,7 @@ int wmain(int argc, const uint16_t *argv[]) { args[i] = win_utf16to8(argv[i]); } - main_real(argc, (const char **)args); + return main_real(argc, (const char **)args); } #else diff --git a/src/version.h b/src/version.h index d269ee8d8..a1ef5e27c 100644 --- a/src/version.h +++ b/src/version.h @@ -1 +1 @@ -#define COMPILER_VERSION "0.4.6" \ No newline at end of file +#define COMPILER_VERSION "0.4.7" \ No newline at end of file diff --git a/test/test_suite/contracts/ct_eval_of_ensure.c3 b/test/test_suite/contracts/ct_eval_of_ensure.c3 index 1d53e2992..7c8209999 100644 --- a/test/test_suite/contracts/ct_eval_of_ensure.c3 +++ b/test/test_suite/contracts/ct_eval_of_ensure.c3 @@ -8,7 +8,7 @@ fn int test(int baz) } extern fn void printf(char*, ...); -fn void main(char[][] args) +fn void main(String[] args) { test(1022); printf("Hello\n"); diff --git a/test/test_suite/define/test_at.c3 b/test/test_suite/define/test_at.c3 index 520e9c591..a48b1bb20 100644 --- a/test/test_suite/define/test_at.c3 +++ b/test/test_suite/define/test_at.c3 @@ -12,6 +12,6 @@ import private foo; define intHello = foo::@hello; // #error: cannot be aliased define @intHello = foo::hello; // #error: cannot use -fn void main(char[][] args) { +fn void main(String[] args) { @intHello(42); } \ No newline at end of file diff --git a/test/test_suite/define/test_at_alias.c3 b/test/test_suite/define/test_at_alias.c3 index f0414ff44..f453dc948 100644 --- a/test/test_suite/define/test_at_alias.c3 +++ b/test/test_suite/define/test_at_alias.c3 @@ -11,6 +11,6 @@ import private foo; define @intHello = foo::@hello; -fn void main(char[][] args) { +fn void main(String[] args) { @intHello(42); } \ No newline at end of file diff --git a/test/test_suite/globals/global_init.c3 b/test/test_suite/globals/global_init.c3 index b3cd2bd2c..eec62d316 100644 --- a/test/test_suite/globals/global_init.c3 +++ b/test/test_suite/globals/global_init.c3 @@ -1,6 +1,6 @@ // TODO string str = "hello"; char* str2 = "hello"; -char[] str3 = "hello"; +String str3 = "hello"; int[2] a1 = { 1, 2 }; diff --git a/test/test_suite/initializer_lists/disallowed_lists.c3 b/test/test_suite/initializer_lists/disallowed_lists.c3 index abfcb2617..6f2225099 100644 --- a/test/test_suite/initializer_lists/disallowed_lists.c3 +++ b/test/test_suite/initializer_lists/disallowed_lists.c3 @@ -1,7 +1,7 @@ fn void test() { char* hello = "123"; - char[] a = { '1', '2', '3' }; + String a = { '1', '2', '3' }; char[*] b = { '1', '2', '3' }; char[3] c = { '1', '2', '3' }; char* d = { '1', '2', '3' }; // #error: Pointers cannot be initialized using an initializer list, instead you need to take the address of an array diff --git a/test/test_suite/methods/extension_method_generic.c3 b/test/test_suite/methods/extension_method_generic.c3 index ab13e4eb1..35c460999 100644 --- a/test/test_suite/methods/extension_method_generic.c3 +++ b/test/test_suite/methods/extension_method_generic.c3 @@ -10,7 +10,7 @@ fn void IntArray.someFunc(IntArray *this, usz param) { this.push((int)param); } -fn int main(char[][] argv) +fn int main(String[] argv) { IntArray stk; stk.someFunc(256); diff --git a/test/test_suite/stdlib/map.c3t b/test/test_suite/stdlib/map.c3t index 2cf149c0c..d8065b054 100644 --- a/test/test_suite/stdlib/map.c3t +++ b/test/test_suite/stdlib/map.c3t @@ -11,7 +11,7 @@ define IntDoubleMap = std::map::HashMap; fn char[] Foo.to_string(Foo* foo, Allocator* allocator = mem::current_allocator()) { - String s = string::new_with_capacity(128, allocator); + VarString s = string::new_with_capacity(128, allocator); s.printf("{%s, %p}", foo.x, foo.bar); return s.str(); } @@ -109,7 +109,7 @@ entry: %lo = load i8*, i8** %17, align 8 %18 = getelementptr inbounds { i8*, i64 }, { i8*, i64 }* %16, i32 0, i32 1 %hi = load i64, i64* %18, align 8 - %19 = call i64 @std_core_string_String_printf(i64* %retparam, i8** %s, i8* getelementptr inbounds ([9 x i8], [9 x i8]* @.str.12, i32 0, i32 0), i64 8, i8* %lo, i64 %hi) + %19 = call i64 @std_core_string_VarString_printf(i64* %retparam, i8** %s, i8* getelementptr inbounds ([9 x i8], [9 x i8]* @.str.12, i32 0, i32 0), i64 8, i8* %lo, i64 %hi) %not_err = icmp eq i64 %19, 0 br i1 %not_err, label %after_check, label %voiderr @@ -118,7 +118,7 @@ after_check: ; preds = %entry voiderr: ; preds = %after_check, %entry %20 = load i8*, i8** %s, align 8 - %21 = call { i8*, i64 } @std_core_string_String_str(i8* %20) + %21 = call { i8*, i64 } @std_core_string_VarString_str(i8* %20) %22 = bitcast %"char[]"* %result to { i8*, i64 }* store { i8*, i64 } %21, { i8*, i64 }* %22, align 8 %23 = bitcast %"char[]"* %result to { i8*, i64 }* diff --git a/test/test_suite2/contracts/ct_eval_of_ensure.c3 b/test/test_suite2/contracts/ct_eval_of_ensure.c3 index 1d53e2992..7c8209999 100644 --- a/test/test_suite2/contracts/ct_eval_of_ensure.c3 +++ b/test/test_suite2/contracts/ct_eval_of_ensure.c3 @@ -8,7 +8,7 @@ fn int test(int baz) } extern fn void printf(char*, ...); -fn void main(char[][] args) +fn void main(String[] args) { test(1022); printf("Hello\n"); diff --git a/test/test_suite2/define/test_at.c3 b/test/test_suite2/define/test_at.c3 index 520e9c591..a48b1bb20 100644 --- a/test/test_suite2/define/test_at.c3 +++ b/test/test_suite2/define/test_at.c3 @@ -12,6 +12,6 @@ import private foo; define intHello = foo::@hello; // #error: cannot be aliased define @intHello = foo::hello; // #error: cannot use -fn void main(char[][] args) { +fn void main(String[] args) { @intHello(42); } \ No newline at end of file diff --git a/test/test_suite2/define/test_at_alias.c3 b/test/test_suite2/define/test_at_alias.c3 index f0414ff44..f453dc948 100644 --- a/test/test_suite2/define/test_at_alias.c3 +++ b/test/test_suite2/define/test_at_alias.c3 @@ -11,6 +11,6 @@ import private foo; define @intHello = foo::@hello; -fn void main(char[][] args) { +fn void main(String[] args) { @intHello(42); } \ No newline at end of file diff --git a/test/test_suite2/globals/global_init.c3 b/test/test_suite2/globals/global_init.c3 index b3cd2bd2c..eec62d316 100644 --- a/test/test_suite2/globals/global_init.c3 +++ b/test/test_suite2/globals/global_init.c3 @@ -1,6 +1,6 @@ // TODO string str = "hello"; char* str2 = "hello"; -char[] str3 = "hello"; +String str3 = "hello"; int[2] a1 = { 1, 2 }; diff --git a/test/test_suite2/initializer_lists/disallowed_lists.c3 b/test/test_suite2/initializer_lists/disallowed_lists.c3 index abfcb2617..6f2225099 100644 --- a/test/test_suite2/initializer_lists/disallowed_lists.c3 +++ b/test/test_suite2/initializer_lists/disallowed_lists.c3 @@ -1,7 +1,7 @@ fn void test() { char* hello = "123"; - char[] a = { '1', '2', '3' }; + String a = { '1', '2', '3' }; char[*] b = { '1', '2', '3' }; char[3] c = { '1', '2', '3' }; char* d = { '1', '2', '3' }; // #error: Pointers cannot be initialized using an initializer list, instead you need to take the address of an array diff --git a/test/test_suite2/methods/extension_method_generic.c3 b/test/test_suite2/methods/extension_method_generic.c3 index ab13e4eb1..35c460999 100644 --- a/test/test_suite2/methods/extension_method_generic.c3 +++ b/test/test_suite2/methods/extension_method_generic.c3 @@ -10,7 +10,7 @@ fn void IntArray.someFunc(IntArray *this, usz param) { this.push((int)param); } -fn int main(char[][] argv) +fn int main(String[] argv) { IntArray stk; stk.someFunc(256); diff --git a/test/test_suite2/stdlib/map.c3t b/test/test_suite2/stdlib/map.c3t index 55c0e3a2b..956177cb9 100644 --- a/test/test_suite2/stdlib/map.c3t +++ b/test/test_suite2/stdlib/map.c3t @@ -11,7 +11,7 @@ define IntDoubleMap = std::map::HashMap; fn char[] Foo.to_string(Foo* foo, Allocator* allocator = mem::current_allocator()) { - String s = string::new_with_capacity(128, allocator); + VarString s = string::new_with_capacity(128, allocator); s.printf("{%s, %p}", foo.x, foo.bar); return s.str(); } @@ -91,7 +91,7 @@ entry: %9 = insertvalue %variant %8, i64 ptrtoint (ptr @"ct$p$void" to i64), 1 %10 = getelementptr inbounds [2 x %variant], ptr %varargslots, i64 0, i64 1 store %variant %9, ptr %10, align 16 - %11 = call i64 @std_core_string_String_printf(ptr %retparam, ptr %s, ptr @.str.12, i64 8, ptr %varargslots, i64 2) + %11 = call i64 @std_core_string_VarString_printf(ptr %retparam, ptr %s, ptr @.str.12, i64 8, ptr %varargslots, i64 2) %not_err = icmp eq i64 %11, 0 br i1 %not_err, label %after_check, label %voiderr @@ -100,7 +100,7 @@ after_check: ; preds = %entry voiderr: ; preds = %after_check, %entry %12 = load ptr, ptr %s, align 8 - %13 = call { ptr, i64 } @std_core_string_String_str(ptr %12) + %13 = call { ptr, i64 } @std_core_string_VarString_str(ptr %12) store { ptr, i64 } %13, ptr %result, align 8 %14 = load { ptr, i64 }, ptr %result, align 8 ret { ptr, i64 } %14 diff --git a/test/unit/stdlib/conv_tests.c3 b/test/unit/stdlib/conv_tests.c3 index 7fd916156..782e625be 100644 --- a/test/unit/stdlib/conv_tests.c3 +++ b/test/unit/stdlib/conv_tests.c3 @@ -1,7 +1,7 @@ module conv_tests; import std::io; -fn void! comparison_helper_32_to_8(Char32 c32, char[] expected_output) +fn void! comparison_helper_32_to_8(Char32 c32, String expected_output) { char[8] out; usz len = conv::char32_to_utf8(c32, &out, 4)?; @@ -12,7 +12,7 @@ fn void! comparison_helper_32_to_8(Char32 c32, char[] expected_output) } } -fn void! comparison_helper_8_to_32(char[] in, Char32 c32) +fn void! comparison_helper_8_to_32(String in, Char32 c32) { usz len = in.len; Char32 res = conv::utf8_to_char32(in.ptr, &len)?; @@ -20,7 +20,7 @@ fn void! comparison_helper_8_to_32(char[] in, Char32 c32) assert(res == c32, "Expected character match."); } -fn void assert_utf8_is_error(char[] in) +fn void assert_utf8_is_error(String in) { usz len = in.len; assert(catch(conv::utf8_to_char32(in.ptr, &len)), "Expected error"); diff --git a/test/unit/stdlib/crypto/rc4.c3 b/test/unit/stdlib/crypto/rc4.c3 index 084ce816c..91a619960 100644 --- a/test/unit/stdlib/crypto/rc4.c3 +++ b/test/unit/stdlib/crypto/rc4.c3 @@ -6,7 +6,7 @@ fn void! rc_crypt() @test Rc4 rc; rc.init(&&x"63727970746969"); char[200] x; - char[] text = "The quick brown fox jumps over the lazy dog."; + String text = "The quick brown fox jumps over the lazy dog."; rc.crypt(text, &x); char[*] res = x"2ac2fecdd8fbb84638e3a4 820eb205cc8e29c28b9d5d