diff --git a/resources/examples/fasta.c3 b/resources/examples/fasta.c3
index 3f425e06a..4c2d1aa23 100644
--- a/resources/examples/fasta.c3
+++ b/resources/examples/fasta.c3
@@ -6,7 +6,7 @@ const IA = 3877;
 const IC = 29573;
 const SEED = 42;
 
-global uint seed = SEED;
+uint seed = SEED;
 
 fn float fasta_rand(float max)
 {
@@ -14,7 +14,7 @@ fn float fasta_rand(float max)
 	return max * seed / IM;
 }
 
-private global char[] alu =
+private char[] alu =
   "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"
   "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"
   "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"
@@ -24,8 +24,8 @@ private global char[] alu =
   "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
 
 
-global char[] iub = "acgtBDHKMNRSVWY";
-global double[] iub_p = {
+char[] iub = "acgtBDHKMNRSVWY";
+double[] iub_p = {
   0.27,
   0.12,
   0.12,
@@ -42,8 +42,8 @@ global double[] iub_p = {
   0.02,
   0.02 };
 
-global char[] homosapiens = "acgt";
-global double[] homosapiens_p = {
+char[] homosapiens = "acgt";
+double[] homosapiens_p = {
   0.3029549426680,
   0.1979883004921,
   0.1975473066391,
diff --git a/resources/examples/notworking/acornvm/avm_stack.c3 b/resources/examples/notworking/acornvm/avm_stack.c3
index 9f3e3a530..d84f3830e 100644
--- a/resources/examples/notworking/acornvm/avm_stack.c3
+++ b/resources/examples/notworking/acornvm/avm_stack.c3
@@ -388,11 +388,11 @@ fn void Value.setTop(Value* th as AintIdx idx)
 }
 
 /* ****************************************
-   GLOBAL VARIABLE ACCESS
+   VARIABLE ACCESS
    ***************************************/
 
 /**
- * Push and return the symbolically-named global variable's value
+ * Push and return the symbolically-named variable's value
  * @require vm(*th).global.isTbl()
  **/
 fn Value Value.pushGloVar(Value* th, string var)
@@ -405,7 +405,7 @@ fn Value Value.pushGloVar(Value* th, string var)
 }
 
 /**
- * Alter the symbolically-named global variable to have the value popped off the local stack
+ * Alter the symbolically-named variable to have the value popped off the local stack
  * @require stkSz(th) > 0, vm(th).global.isTbl()
  **/
 fn void Value.popGloVar(Value* th, string var)
@@ -417,7 +417,7 @@ fn void Value.popGloVar(Value* th, string var)
 	th(*th).stk_top -= 2; // Pop key & value after value is safely in Global
 }
 
-/* Push the value of the current process thread's global variable table. */
+/* Push the value of the current process thread's variable table. */
 Value pushGlobal(Value th)
 {
 	stkCanIncTop(th); /* Check if there is room */
diff --git a/resources/examples/notworking/acornvm/gen.c3 b/resources/examples/notworking/acornvm/gen.c3
index ce69b7c7f..fdc4a0f62 100644
--- a/resources/examples/notworking/acornvm/gen.c3
+++ b/resources/examples/notworking/acornvm/gen.c3
@@ -381,7 +381,7 @@ void genAssign(CompInfo *comp, Value lval, Value rval) {
 	if (opcode)
 		genDoProp(comp, lval, opcode, rval, 1);
 	else {
-		// Handle parallel, local, closure, global variable assignments where rval is loaded first
+		// Handle parallel, local, closure, variable assignments where rval is loaded first
 		int nlvals = lvalop==vmlit(SymComma)? arr_size(lval)-1 : 1;
 		bool varrvals = false;
 		AuintIdx rvalreg;
@@ -445,7 +445,7 @@ void genAssign(CompInfo *comp, Value lval, Value rval) {
 				genAddInstr(comp, BCINS_ABC(OpLoadReg, localreg, rvalreg, 0));
 			else if ((localreg = findClosureVar(comp, symnm))!=-1)
 				genAddInstr(comp, BCINS_ABC(OpSetClosure, localreg, rvalreg, 0));
-		// Load into a global variable
+		// Load into a variable
 		} else if (vmlit(SymGlobal) == lvalop)
 			genAddInstr(comp, BCINS_ABx(OpSetGlobal, rvalreg, genAddLit(comp, astGet(th, lval, 1))));
 	}
diff --git a/resources/examples/notworking/acornvm/parser.c3 b/resources/examples/notworking/acornvm/parser.c3
index 9fc6bcb0d..04b1e9806 100644
--- a/resources/examples/notworking/acornvm/parser.c3
+++ b/resources/examples/notworking/acornvm/parser.c3
@@ -143,7 +143,7 @@ void parseValue(CompInfo* comp, Value astseg)
 		astAddSeg2(th, astseg, vmlit(SYM_EXT), anInt(genAddUrlLit(comp, comp->lex->token)));
 		lexGetNextToken(comp->lex);
 	}
-	// Local or global variable / name token
+	// Local or variable / name token
 	else if (comp->lex->toktype == Name_Token) {
 		Value symnm = pushValue(th, comp->lex->token);
 		lexGetNextToken(comp->lex);
@@ -240,7 +240,7 @@ void parseValue(CompInfo* comp, Value astseg)
 					Value symnm = comp->lex->token;
 					const char first = (toStr(symnm))[0];
 					if (first=='$' || (first>='A' && first<='Z'))
-						lexLog(comp->lex, "A global name may not be a closure variable");
+						lexLog(comp->lex, "A name may not be a closure variable");
 					arrAdd(th, comp->clovarseg, symnm);
 					lexGetNextToken(comp->lex);
 
@@ -985,7 +985,7 @@ void parseProgram(CompInfo* comp) {
 				Value symnm = comp->lex->token;
 				const char first = (toStr(symnm))[0];
 				if (first=='$' || (first>='A' && first<='Z'))
-					lexLog(comp->lex, "A global name may not be a method parameter");
+					lexLog(comp->lex, "A name may not be a method parameter");
 				else {
 					if (findLocalVar(comp, symnm)==-1) {
 						arrAdd(th, comp->locvarseg, symnm);
diff --git a/resources/examples/notworking/acornvm/vm.c3 b/resources/examples/notworking/acornvm/vm.c3
index 7ac1daeb3..8a592061a 100644
--- a/resources/examples/notworking/acornvm/vm.c3
+++ b/resources/examples/notworking/acornvm/vm.c3
@@ -13,7 +13,7 @@ void core_init(Value th); // Initialize all core types
  *   different encoding types.
  * - The symbol table, which is shared across everywhere
  * - The main thread, which is the recursive root for garbage collection.
- *   The thread manages the global namespace, including all registered
+ *   The thread manages the namespace, including all registered
  *   core types (including the Acorn compiler and resource types).
  *
  * See newVm() for more detailed information on VM initialization.
@@ -34,12 +34,12 @@ struct VmInfo
 	ulong pcgrng_state;		    //!< PCG random-number generator state
 	ulong pcgrng_inc;	    	//!< PCG random-number generator inc value
 
-	Value global;				//!< VM's "built in" Global hash table
+	Value global;				//!< VM's "built in" hash table
 
 	Value main_thread;			//!< VM's main thread
 	ThreadInfo main_thr;        //!< State space for main thread
 
-	SymTable sym_table;	        //!< global symbol table
+	SymTable sym_table;	        //!< symbol table
 	AuintIdx hashseed;			//!< randomized seed for hashing strings
 	Value literals;				//!< array of all built-in symbol and type literals
 	Value stdidx;				//!< Table to convert std symbol to index
@@ -252,7 +252,7 @@ macro memcpy_Auint(i, val)
  *   and which to discard.
  * - All value encodings are initialized next, including the single symbol table
  *   used across the VM.
- * - The main thread is started up, initializing its global namespace.
+ * - The main thread is started up, initializing its namespace.
  * - All core types are progressively loaded, establishing the default types for
  *   each encoding. This includes the resource types and Acorn compiler. */
 fn Value new(void)
@@ -290,13 +290,13 @@ fn Value new(void)
 	memcpy_Auint(3, &newVM)		// public function
 	vm->hashseed = tblCalcStrHash(seedstr, sizeof(seedstr), (AuintIdx) timehash);
 
-	// Initialize vm-wide symbol table, global table and literals
+	// Initialize vm-wide symbol table, table and literals
 	sym_init(th); // Initialize hash table for symbols
-	newTbl(th, &vm->global, aNull, GLOBAL_NEWSIZE); // Create global hash table
+	newTbl(th, &vm->global, aNull, GLOBAL_NEWSIZE); // Create hash table
 	mem_markChk(th, vm, vm->global);
 	vm_litinit(th); // Load reserved and standard symbols into literal list
-	core_init(th); // Load up global table and literal list with core types
-	setType(th, vm->global, vmlit(TypeIndexm)); // Fix up type info for global table
+	core_init(th); // Load up table and literal list with core types
+	setType(th, vm->global, vmlit(TypeIndexm)); // Fix up type info for table
 
 	// Initialize byte-code standard methods and the Acorn compiler
 	vm_stdinit(th);
diff --git a/resources/testfragments/lexertest.c3 b/resources/testfragments/lexertest.c3
index 5df2d1517..825bcf28e 100644
--- a/resources/testfragments/lexertest.c3
+++ b/resources/testfragments/lexertest.c3
@@ -1,6 +1,6 @@
 module foo;
 
-const int GLOBAL = 0;
+const int = 0;
 
 struct Boo
 {
diff --git a/src/compiler/compiler_internal.h b/src/compiler/compiler_internal.h
index af8aaeab8..edb498238 100644
--- a/src/compiler/compiler_internal.h
+++ b/src/compiler/compiler_internal.h
@@ -365,7 +365,7 @@ typedef struct VarDecl_
 	bool unwrap : 1;
 	bool vararg : 1;
 	bool is_static : 1;
-	bool is_threadglobal : 1;
+	bool is_threadlocal : 1;
 	TypeInfo *type_info;
 	union
 	{
diff --git a/src/compiler/enums.h b/src/compiler/enums.h
index 4e926bc98..c7b21ccf3 100644
--- a/src/compiler/enums.h
+++ b/src/compiler/enums.h
@@ -442,7 +442,7 @@ typedef enum
 	TOKEN_FN,
 	TOKEN_FUNC,
 	TOKEN_GENERIC,
-	TOKEN_GLOBAL,
+	TOKEN_TLOCAL,
 	TOKEN_IF,
 	TOKEN_IMPORT,
 	TOKEN_MACRO,
diff --git a/src/compiler/lexer.c b/src/compiler/lexer.c
index 78e7b0ded..300677eef 100644
--- a/src/compiler/lexer.c
+++ b/src/compiler/lexer.c
@@ -691,7 +691,7 @@ static inline bool scan_char(Lexer *lexer)
 
 	int width = 0;
 	char c;
-	Int128 b = {};
+	Int128 b = { 0, 0 };
 
 	while ((c = next(lexer)) != '\'')
 	{
diff --git a/src/compiler/llvm_codegen.c b/src/compiler/llvm_codegen.c
index c829320bf..de7e15be8 100644
--- a/src/compiler/llvm_codegen.c
+++ b/src/compiler/llvm_codegen.c
@@ -363,8 +363,7 @@ void llvm_emit_global_variable_init(GenContext *c, Decl *decl)
 	// TODO fix name
 	LLVMValueRef old = decl->backend_ref;
 	decl->backend_ref = LLVMAddGlobal(c->module, LLVMTypeOf(init_value), decl->extname ? decl->extname : decl->external_name);
-	bool thread_local = !decl->var.is_threadglobal && decl->var.kind != VARDECL_CONST;
-	LLVMSetThreadLocal(decl->backend_ref, thread_local);
+	LLVMSetThreadLocal(decl->backend_ref, decl->var.is_threadlocal);
 	if (decl->section)
 	{
 		LLVMSetSection(decl->backend_ref, decl->section);
@@ -375,7 +374,7 @@ void llvm_emit_global_variable_init(GenContext *c, Decl *decl)
 	if (failable_ref)
 	{
 		llvm_set_alignment(failable_ref, type_alloca_alignment(type_anyerr));
-		LLVMSetThreadLocal(failable_ref, thread_local);
+		LLVMSetThreadLocal(failable_ref, decl->var.is_threadlocal);
 	}
 	if (init_expr && IS_FAILABLE(init_expr) && init_expr->expr_kind == EXPR_FAILABLE)
 	{
diff --git a/src/compiler/parse_global.c b/src/compiler/parse_global.c
index 797c52810..dfe810527 100644
--- a/src/compiler/parse_global.c
+++ b/src/compiler/parse_global.c
@@ -805,8 +805,8 @@ Decl *parse_decl(Context *context)
 		return parse_const_declaration(context, VISIBLE_LOCAL);
 	}
 
-	bool is_threadglobal = try_consume(context, TOKEN_GLOBAL);
-	bool is_static = !is_threadglobal && try_consume(context, TOKEN_STATIC);
+	bool is_threadlocal = try_consume(context, TOKEN_TLOCAL);
+	bool is_static = !is_threadlocal && try_consume(context, TOKEN_STATIC);
 
 	ASSIGN_TYPE_ELSE(TypeInfo *type, parse_failable_type(context), poisoned_decl);
 
@@ -816,8 +816,8 @@ Decl *parse_decl(Context *context)
 		SEMA_ERROR(decl, "You cannot use unwrap with a failable variable.");
 		return poisoned_decl;
 	}
-	decl->var.is_static = is_static || is_threadglobal;
-	decl->var.is_threadglobal = is_threadglobal;
+	decl->var.is_static = is_static || is_threadlocal;
+	decl->var.is_threadlocal = is_threadlocal;
 	return decl;
 }
 
@@ -1021,13 +1021,13 @@ bool parse_attributes(Context *context, Attr ***attributes_ref)
  */
 static inline Decl *parse_global_declaration(Context *context, Visibility visibility)
 {
-	bool thread_global = try_consume(context, TOKEN_GLOBAL);
+	bool threadlocal = try_consume(context, TOKEN_TLOCAL);
 
 	ASSIGN_TYPE_ELSE(TypeInfo *type, parse_failable_type(context), poisoned_decl);
 
 	Decl *decl = decl_new_var(context->tok.id, type, VARDECL_GLOBAL, visibility);
 
-	decl->var.is_threadglobal = thread_global;
+	decl->var.is_threadlocal = threadlocal;
 
 	if (TOKEN_IS(TOKEN_CONST_IDENT))
 	{
@@ -2366,7 +2366,7 @@ Decl *parse_top_level_statement(Context *context)
 		case TOKEN_IMPORT:
 			SEMA_TOKEN_ERROR(context->tok, "Imports are only allowed directly after the module declaration.");
 			return poisoned_decl;
-		case TOKEN_GLOBAL:
+		case TOKEN_TLOCAL:
 		case TYPELIKE_TOKENS:
 		{
 			ASSIGN_DECL_ELSE(decl, parse_global_declaration(context, visibility), poisoned_decl);
diff --git a/src/compiler/parse_stmt.c b/src/compiler/parse_stmt.c
index 4d6dd7ad4..1f8392315 100644
--- a/src/compiler/parse_stmt.c
+++ b/src/compiler/parse_stmt.c
@@ -800,7 +800,7 @@ Ast *parse_stmt(Context *context)
 			return parse_decl_or_expr_stmt(context);
 		case TOKEN_VAR:
 			return parse_var_stmt(context);
-		case TOKEN_GLOBAL: // Global means declaration!
+		case TOKEN_TLOCAL: // Global means declaration!
 		case TOKEN_STATIC:   // Static means declaration!
 		case TOKEN_CONST:   // Const means declaration!
 			return parse_declaration_stmt(context);
diff --git a/src/compiler/tokens.c b/src/compiler/tokens.c
index 2e47bad72..c81cf357d 100644
--- a/src/compiler/tokens.c
+++ b/src/compiler/tokens.c
@@ -236,8 +236,6 @@ const char *token_type_to_string(TokenType type)
 			return "func";
 		case TOKEN_GENERIC:
 			return "generic";
-		case TOKEN_GLOBAL:
-			return "global";
 		case TOKEN_IF:
 			return "if";
 		case TOKEN_IMPORT:
@@ -260,6 +258,8 @@ const char *token_type_to_string(TokenType type)
 			return "struct";
 		case TOKEN_SWITCH:
 			return "switch";
+		case TOKEN_TLOCAL:
+			return "tlocal";
 		case TOKEN_TRUE:
 			return "true";
 		case TOKEN_TRY:
diff --git a/test/test_suite/arrays/array_struct.c3t b/test/test_suite/arrays/array_struct.c3t
index d585a07f6..304ec68ea 100644
--- a/test/test_suite/arrays/array_struct.c3t
+++ b/test/test_suite/arrays/array_struct.c3t
@@ -6,7 +6,7 @@ struct Foo
     int x, y;
 }
 
-private global Foo[10] array;
+private Foo[10] array;
 
 // #expect: test.ll
 
diff --git a/test/test_suite/arrays/complex_array_const.c3t b/test/test_suite/arrays/complex_array_const.c3t
index a532ff7dd..c5a387497 100644
--- a/test/test_suite/arrays/complex_array_const.c3t
+++ b/test/test_suite/arrays/complex_array_const.c3t
@@ -8,7 +8,7 @@ struct Connection
    long length;
 }
 
-private global Connection[3] link
+private Connection[3] link
 = { {1, "link1", 10},
     {2, "link2", 20},
     {3, "link3", 30} };
diff --git a/test/test_suite/compile_time/compile_time_ptr_ref.c3t b/test/test_suite/compile_time/compile_time_ptr_ref.c3t
index da64ee139..404ed8405 100644
--- a/test/test_suite/compile_time/compile_time_ptr_ref.c3t
+++ b/test/test_suite/compile_time/compile_time_ptr_ref.c3t
@@ -2,12 +2,12 @@
 module test;
 
 
-global int*[] blurp = { &ptr, &ptr, (&ptr + 1), &ptr - 1, (int*)((iptr)(&ptr) - 4) };
-global int* c = (int*)((iptr)(&ptr) - 4);
-global int* c2 = (int*)((iptr)(&ptr) + 4);
-global int* c3 = (int*)(4 + (iptr)(&ptr));
-global iptr ff = (iptr)(&ptr);
-global int ptr = 0;
+int*[] blurp = { &ptr, &ptr, (&ptr + 1), &ptr - 1, (int*)((iptr)(&ptr) - 4) };
+int* c = (int*)((iptr)(&ptr) - 4);
+int* c2 = (int*)((iptr)(&ptr) + 4);
+int* c3 = (int*)(4 + (iptr)(&ptr));
+iptr ff = (iptr)(&ptr);
+int ptr = 0;
 
 // #expect: test.ll
 
diff --git a/test/test_suite/compile_time/ct_if.c3t b/test/test_suite/compile_time/ct_if.c3t
index 269cfae02..006554164 100644
--- a/test/test_suite/compile_time/ct_if.c3t
+++ b/test/test_suite/compile_time/ct_if.c3t
@@ -4,7 +4,7 @@ $else:
     $elif (0):
     $elif (0):
     $else:
-        global int x = 1;
+        int x = 1;
     $endif;
 $endif;
 
@@ -18,7 +18,7 @@ $endif;
 
 $if (1):
 $assert(true);
-global int d = 5;
+int d = 5;
 $elif (0):
 $assert(false);
 $else:
@@ -29,7 +29,7 @@ $if (0):
 $assert(true);
 $elif (1):
 $assert(true);
-global int c = 5;
+int c = 5;
 $else:
 $assert(false);
 $endif;
@@ -38,7 +38,7 @@ $if (0):
 $assert(true);
 $elif (1):
 $assert(true);
-global int b = 4;
+int b = 4;
 $elif (0):
 $assert(false);
 $else:
@@ -51,7 +51,7 @@ $elif (0):
 $assert(false);
 $elif (1):
 $assert(true);
-global int a = 3;
+int a = 3;
 $else:
 $assert(false);
 $endif;
diff --git a/test/test_suite/compile_time/ternary_folding.c3t b/test/test_suite/compile_time/ternary_folding.c3t
index 6bf2f0619..58b361351 100644
--- a/test/test_suite/compile_time/ternary_folding.c3t
+++ b/test/test_suite/compile_time/ternary_folding.c3t
@@ -1,8 +1,8 @@
 // #target: x64-darwin
 
-global int foo = 2.2 ? 1 : 2;
-global double bar = false ? 1.0 : 2;
-global bool baz = 1 ? false : true;
+int foo = 2.2 ? 1 : 2;
+double bar = false ? 1.0 : 2;
+bool baz = 1 ? false : true;
 
 fn void test()
 {
diff --git a/test/test_suite/compile_time_introspection/alignof.c3t b/test/test_suite/compile_time_introspection/alignof.c3t
index 9eb117325..259cf2831 100644
--- a/test/test_suite/compile_time_introspection/alignof.c3t
+++ b/test/test_suite/compile_time_introspection/alignof.c3t
@@ -1,7 +1,7 @@
 // #target: x64-darwin
 module foo;
 
-global int[100] zfe;
+int[100] zfe;
 struct Bob
 {
     Bob[] x;
@@ -37,29 +37,29 @@ union Foob
 Ar izzy;
 
 
-global long x = $alignof(zfe);
-global short y = $alignof("Bob.y");
-global int z = $alignof("Bob.y");
-global int w = $alignof(Bob.y);
-global int v = $alignof(v);
-global int x1 = $alignof("Ex.c");
-global int x2 = $alignof(Ex.y);
-global int x3 = $alignof(char[8]);
-global int x4 = $alignof("Ar.br[1]");
-global int x5 = $alignof(Ar.br[1]);
-global int x6 = $alignof(Ar.br[1]);
-global int x7 = $alignof(Ar.br[1]);
-global int x8 = $alignof(Ar.br[2]);
-global int x9 = $alignof("izzy.br[1]");
-global int x10 = $alignof("izzy.br[1]");
-global int x11 = $alignof(izzy.br[1]);
-global int z0 = $alignof("Foob.c");
-global int z00 = $alignof("Foob.c[0]");
-global int z01 = $alignof("Foob.c[1]");
-global int z02 = $alignof("Foob.c[2]");
-global int z03 = $alignof("Foob.c[3]");
-global int z04 = $alignof("Foob.c[4]");
-global int z05 = $alignof("Foob.c[5]");
+long x = $alignof(zfe);
+short y = $alignof("Bob.y");
+int z = $alignof("Bob.y");
+int w = $alignof(Bob.y);
+int v = $alignof(v);
+int x1 = $alignof("Ex.c");
+int x2 = $alignof(Ex.y);
+int x3 = $alignof(char[8]);
+int x4 = $alignof("Ar.br[1]");
+int x5 = $alignof(Ar.br[1]);
+int x6 = $alignof(Ar.br[1]);
+int x7 = $alignof(Ar.br[1]);
+int x8 = $alignof(Ar.br[2]);
+int x9 = $alignof("izzy.br[1]");
+int x10 = $alignof("izzy.br[1]");
+int x11 = $alignof(izzy.br[1]);
+int z0 = $alignof("Foob.c");
+int z00 = $alignof("Foob.c[0]");
+int z01 = $alignof("Foob.c[1]");
+int z02 = $alignof("Foob.c[2]");
+int z03 = $alignof("Foob.c[3]");
+int z04 = $alignof("Foob.c[4]");
+int z05 = $alignof("Foob.c[5]");
 
 
 
diff --git a/test/test_suite/compile_time_introspection/offsetof.c3t b/test/test_suite/compile_time_introspection/offsetof.c3t
index 386ebf574..5ad956f71 100644
--- a/test/test_suite/compile_time_introspection/offsetof.c3t
+++ b/test/test_suite/compile_time_introspection/offsetof.c3t
@@ -1,7 +1,7 @@
 // #target: x64-darwin
 module foo;
 
-global int[100] zfe;
+int[100] zfe;
 struct Bob
 {
     Bob[] x;
@@ -36,21 +36,21 @@ union Foob
 }
 
 
-global short y = $offsetof("Bob.y");
-global int z = $offsetof("Bob.y");
-global int w = $offsetof(Bob.y);
-global int x1 = $offsetof("Ex.c[3]");
-global int x2 = $offsetof("Ex.y[1]");
-global int x4 = $offsetof("Ar.br[1]");
-global int x6 = $offsetof(Ar.br[1].x);
-global int x5 = $offsetof(Ar.br[1]);
-global int x7 = $offsetof("Ar.br[2].x");
-global int x8 = $offsetof(Ar.br[2]);
-global int z0 = $offsetof("Foob.c");
-global int z00 = $offsetof("Foob.c[0]");
-global int z01 = $offsetof("Foob.c[1]");
-global int z02 = $offsetof("Foob.c[5]");
-global int z03 = $offsetof("Foob.a");
+short y = $offsetof("Bob.y");
+int z = $offsetof("Bob.y");
+int w = $offsetof(Bob.y);
+int x1 = $offsetof("Ex.c[3]");
+int x2 = $offsetof("Ex.y[1]");
+int x4 = $offsetof("Ar.br[1]");
+int x6 = $offsetof(Ar.br[1].x);
+int x5 = $offsetof(Ar.br[1]);
+int x7 = $offsetof("Ar.br[2].x");
+int x8 = $offsetof(Ar.br[2]);
+int z0 = $offsetof("Foob.c");
+int z00 = $offsetof("Foob.c[0]");
+int z01 = $offsetof("Foob.c[1]");
+int z02 = $offsetof("Foob.c[5]");
+int z03 = $offsetof("Foob.a");
 
 // #expect: foo.ll
 @foo.y = global i16 16, align 2
diff --git a/test/test_suite/compile_time_introspection/sizeof.c3t b/test/test_suite/compile_time_introspection/sizeof.c3t
index d95cf90fc..a0e8fe74d 100644
--- a/test/test_suite/compile_time_introspection/sizeof.c3t
+++ b/test/test_suite/compile_time_introspection/sizeof.c3t
@@ -2,22 +2,22 @@ module foo;
 import bar;
 import bar::abc;
 
-global long x = $sizeof(Baz);
-global short y = $sizeof("Baz");
-global int z = $sizeof(bar::Baz);
-global int w = $sizeof("bar::Baz");
-global int v = $sizeof("bar::abc::Foo");
-global int x1 = $sizeof(x);
-global int y1 = $sizeof("y");
-global int a = $sizeof("Baz.y");
-global int b = $sizeof("Deep.a.b");
-global int c = $sizeof("Deep.a.b.c");
-global int d = $sizeof("Deep[][100]");
-global int e = $sizeof("Deep[][100]**[100][]*");
-global int a2 = $sizeof("Baz.y");
-global int a3 = $sizeof(Baz.y);
-global int a4 = $sizeof(Baz.y);
-global int a5 = $sizeof(Baz.y);
+long x = $sizeof(Baz);
+short y = $sizeof("Baz");
+int z = $sizeof(bar::Baz);
+int w = $sizeof("bar::Baz");
+int v = $sizeof("bar::abc::Foo");
+int x1 = $sizeof(x);
+int y1 = $sizeof("y");
+int a = $sizeof("Baz.y");
+int b = $sizeof("Deep.a.b");
+int c = $sizeof("Deep.a.b.c");
+int d = $sizeof("Deep[][100]");
+int e = $sizeof("Deep[][100]**[100][]*");
+int a2 = $sizeof("Baz.y");
+int a3 = $sizeof(Baz.y);
+int a4 = $sizeof(Baz.y);
+int a5 = $sizeof(Baz.y);
 
 module bar;
 
diff --git a/test/test_suite/constants/byte_literals.c3t b/test/test_suite/constants/byte_literals.c3t
index 28c6d00cf..9909bc1f5 100644
--- a/test/test_suite/constants/byte_literals.c3t
+++ b/test/test_suite/constants/byte_literals.c3t
@@ -1,8 +1,8 @@
-global char[*] foob = x"a0";
-global char[*] fooz = x"00aabbccddeeff";
-global char[*] fooy = x'dead beef';
-global char[*] foow = x"4549234d e d";
-global char[*] foo64 = b64"SGVsbG8gV29ybGQ=";
+char[*] foob = x"a0";
+char[*] fooz = x"00aabbccddeeff";
+char[*] fooy = x'dead beef';
+char[*] foow = x"4549234d e d";
+char[*] foo64 = b64"SGVsbG8gV29ybGQ=";
 
 // #expect: byte_literals.ll
 
diff --git a/test/test_suite/constants/char_literals.c3t b/test/test_suite/constants/char_literals.c3t
index dc1f3d3d7..2a3aa06d0 100644
--- a/test/test_suite/constants/char_literals.c3t
+++ b/test/test_suite/constants/char_literals.c3t
@@ -1,15 +1,15 @@
 // #file: file1.c3
 module test;
 
-global char a = ' ';
-global char b = '\r';
-global char c = '\t';
-global char d = '\n';
-global char e = '\0';
-global char f = '\'';
-global char g = '"';
-global char h = '\\';
-global char i = '\e';
+char a = ' ';
+char b = '\r';
+char c = '\t';
+char d = '\n';
+char e = '\0';
+char f = '\'';
+char g = '"';
+char h = '\\';
+char i = '\e';
 
 // #expect: test.ll
 
diff --git a/test/test_suite/constants/constants.c3t b/test/test_suite/constants/constants.c3t
index 91bc6f184..821669e4a 100644
--- a/test/test_suite/constants/constants.c3t
+++ b/test/test_suite/constants/constants.c3t
@@ -5,11 +5,11 @@ private const uint DD = FOO;
 
 private const FOO = ~(uint)(0);
 
-private global uint x = AA;
-private global uint z = CC;
-private global char w = (char)(FOO);
-private global ushort v = (ushort)(FOO);
-private global uint z2 = DD;
+private uint x = AA;
+private uint z = CC;
+private char w = (char)(FOO);
+private ushort v = (ushort)(FOO);
+private uint z2 = DD;
 
 fn void test()
 {
diff --git a/test/test_suite/enumerations/compile_time.c3t b/test/test_suite/enumerations/compile_time.c3t
index 64ecd627e..d51584493 100644
--- a/test/test_suite/enumerations/compile_time.c3t
+++ b/test/test_suite/enumerations/compile_time.c3t
@@ -5,11 +5,11 @@ enum MyEnum : short
     BYE = -5
 }
 
-global int myenum_max = MyEnum.max;
-global int myenum_min = MyEnum.min;
-global int myenum_elements = MyEnum.elements;
-global int myenum_alignof = $alignof(MyEnum);
-global int myenum_sizeof = $sizeof(MyEnum);
+int myenum_max = MyEnum.max;
+int myenum_min = MyEnum.min;
+int myenum_elements = MyEnum.elements;
+int myenum_alignof = $alignof(MyEnum);
+int myenum_sizeof = $sizeof(MyEnum);
 
 // #expect: compile_time.ll
 
diff --git a/test/test_suite/expressions/parsed_numbers.c3t b/test/test_suite/expressions/parsed_numbers.c3t
index 5ee674d03..727d824eb 100644
--- a/test/test_suite/expressions/parsed_numbers.c3t
+++ b/test/test_suite/expressions/parsed_numbers.c3t
@@ -1,9 +1,9 @@
 module numbers;
 
-global double a = 0x1.1p+1;
-global double b = -12.3e-12;
-global double c = 0x1.1p-1;
-global double d = 12.3e+12;
+double a = 0x1.1p+1;
+double b = -12.3e-12;
+double c = 0x1.1p-1;
+double d = 12.3e+12;
 
 // #expect: numbers.ll
 
diff --git a/test/test_suite/functions/static_vars.c3t b/test/test_suite/functions/static_vars.c3t
index 4cb83d501..a9d2a35f6 100644
--- a/test/test_suite/functions/static_vars.c3t
+++ b/test/test_suite/functions/static_vars.c3t
@@ -3,15 +3,15 @@ module foo;
 fn int test()
 {
     static int x = 1;
-    global int y = 2;
+    tlocal int y = 2;
     x++;
     return x;
 }
 
 // #expect: foo.ll
 
-@test.x = hidden thread_local global i32 1, align 4
-@test.y = hidden global i32 2, align 4
+@test.x = hidden global i32 1, align 4
+@test.y = hidden thread_local global i32 2, align 4
 
 define i32 @foo.test()
 
diff --git a/test/test_suite/functions/test_regression.c3t b/test/test_suite/functions/test_regression.c3t
index 388e2207d..e8bd39f1c 100644
--- a/test/test_suite/functions/test_regression.c3t
+++ b/test/test_suite/functions/test_regression.c3t
@@ -15,7 +15,7 @@ fn void helloWorld()
 }
 fn int test_static()
 {
-    global int x = 1;
+    static int x = 1;
     x++;
     printf("Test static %d\n", x);
     return x;
@@ -201,7 +201,7 @@ fn Type getMult(Type a)
 {
     return a * a;
 }
-global Type argh = 234;
+Type argh = 234;
 
 errtype MyErr
 {
diff --git a/test/test_suite/functions/test_regression_mingw.c3t b/test/test_suite/functions/test_regression_mingw.c3t
index 9e2b47ad4..f39b5313b 100644
--- a/test/test_suite/functions/test_regression_mingw.c3t
+++ b/test/test_suite/functions/test_regression_mingw.c3t
@@ -15,7 +15,7 @@ fn void helloWorld()
 }
 fn int test_static()
 {
-    global int x = 1;
+    static int x = 1;
     x++;
     printf("Test static %d\n", x);
     return x;
@@ -203,7 +203,7 @@ fn Type getMult(Type a)
 {
     return a * a;
 }
-global Type argh = 234;
+Type argh = 234;
 
 errtype MyErr
 {
diff --git a/test/test_suite/globals/external_global.c3t b/test/test_suite/globals/external_global.c3t
index 0c7527f98..eca23cf05 100644
--- a/test/test_suite/globals/external_global.c3t
+++ b/test/test_suite/globals/external_global.c3t
@@ -13,7 +13,7 @@ struct UzGlobs
     MinInfo* pInfo;
 }
 
-extern global UzGlobs g;
+extern UzGlobs g;
 
 fn int extract_or_test_files()
 {
diff --git a/test/test_suite/globals/global_extname.c3t b/test/test_suite/globals/global_extname.c3t
index 71514a523..26f486e22 100644
--- a/test/test_suite/globals/global_extname.c3t
+++ b/test/test_suite/globals/global_extname.c3t
@@ -1,6 +1,6 @@
 module foo;
 
-global int baz @extname("foobar") = 123;
+int baz @extname("foobar") = 123;
 
 // #expect: foo.ll
 
diff --git a/test/test_suite/initializer_lists/fasta.c3t b/test/test_suite/initializer_lists/fasta.c3t
index a486f7176..384c00b8d 100644
--- a/test/test_suite/initializer_lists/fasta.c3t
+++ b/test/test_suite/initializer_lists/fasta.c3t
@@ -6,7 +6,7 @@ const IA = 3877u;
 const IC = 29573u;
 const SEED = 42u;
 
-global uint seed = SEED;
+uint seed = SEED;
 
 fn float fasta_rand(float max)
 {
@@ -14,7 +14,7 @@ fn float fasta_rand(float max)
 	return max * seed / IM;
 }
 
-private global char[] alu =
+private char[] alu =
   "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"
   "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"
   "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"
@@ -27,8 +27,8 @@ extern fn int atoi(char *s);
 extern fn int printf(char *s, ...);
 extern fn void putchar(int c);
 
-global char[] iub = "acgtBDHKMNRSVWY";
-global double[] iub_p = {
+char[] iub = "acgtBDHKMNRSVWY";
+double[] iub_p = {
   0.27,
   0.12,
   0.12,
@@ -45,8 +45,8 @@ global double[] iub_p = {
   0.02,
   0.02 };
 
-global char[] homosapiens = "acgt";
-global double[] homosapiens_p = {
+char[] homosapiens = "acgt";
+double[] homosapiens_p = {
   0.3029549426680,
   0.1979883004921,
   0.1975473066391,
diff --git a/test/test_suite/initializer_lists/general_tests.c3t b/test/test_suite/initializer_lists/general_tests.c3t
index edb9fc371..6e8758cff 100644
--- a/test/test_suite/initializer_lists/general_tests.c3t
+++ b/test/test_suite/initializer_lists/general_tests.c3t
@@ -17,7 +17,7 @@ fn int test()
     int[1] azz = {};
     int[*] a = {};
     var $foo = { 11, 22, 33 };
-    global int foo1 = $foo[1];
+    static int foo1 = $foo[1];
     int foo2 = $foo[2];
     var $foos = { "Hello!" };
     char* str = $foos[0];
diff --git a/test/test_suite/initializer_lists/statics.c3t b/test/test_suite/initializer_lists/statics.c3t
index 0ddd377c6..2baf910a0 100644
--- a/test/test_suite/initializer_lists/statics.c3t
+++ b/test/test_suite/initializer_lists/statics.c3t
@@ -16,7 +16,7 @@ struct Bar
 fn void test()
 {
     Bar[] b = { { 1, 2 } };
-    global Bar[] c = { { 1, 2 } };
+    static Bar[] c = { { 1, 2 } };
     io::printf("%d %d\n", b[0].y, c[0].y);
     b[0].y += 1;
     c[0].y += 1;
@@ -30,7 +30,7 @@ fn int main()
     return 1;
 }
 
-// #expect: statics.ll
+/* #expect: statics.ll
 
 %Bar = type { i32, i32 }
 %"Bar[]" = type { %Bar*, i64 }
diff --git a/test/test_suite/initializer_lists/subarrays.c3t b/test/test_suite/initializer_lists/subarrays.c3t
index e51c8fbfe..523cad75e 100644
--- a/test/test_suite/initializer_lists/subarrays.c3t
+++ b/test/test_suite/initializer_lists/subarrays.c3t
@@ -14,9 +14,9 @@ struct Bar
 }
 
 
-global Bar[] arrbar = { { 3, 4 }, { 8, 9 }};
-global int[] xd = { 1, 2 };
-global int* fofeo = &&(int[2]{ 3, 4 });
+Bar[] arrbar = { { 3, 4 }, { 8, 9 }};
+int[] xd = { 1, 2 };
+int* fofeo = &&(int[2]{ 3, 4 });
 
 fn int main()
 {
diff --git a/test/test_suite/literals/literal_general.c3t b/test/test_suite/literals/literal_general.c3t
index bd38675cd..b09e6fdb0 100644
--- a/test/test_suite/literals/literal_general.c3t
+++ b/test/test_suite/literals/literal_general.c3t
@@ -1,14 +1,14 @@
 // #target: x64-darwin
 module foo;
 
-global int aa = 'ä';
-global int x = 'ABCD';
-global uint y = 'Helo';
-global ushort z = '\x31\x32';
-global int d = '\u0031';
-global char b = '\x40';
-global uint abc = '\U133222AB';
-global uint foo = '謝';
+int aa = 'ä';
+int x = 'ABCD';
+uint y = 'Helo';
+ushort z = '\x31\x32';
+int d = '\u0031';
+char b = '\x40';
+uint abc = '\U133222AB';
+uint foo = '謝';
 
 /* #expect: foo.ll
 
diff --git a/test/test_suite/pointers/const_pointer.c3t b/test/test_suite/pointers/const_pointer.c3t
index 9a3e95558..78ab41b2b 100644
--- a/test/test_suite/pointers/const_pointer.c3t
+++ b/test/test_suite/pointers/const_pointer.c3t
@@ -2,13 +2,13 @@
 
 module const_pointer;
 
-private global double foo = 17;
-private global double bar = 12.0;
-private global float xx = 12.0;
+private double foo = 17;
+private double bar = 12.0;
+private float xx = 12.0;
 
-private global void*[3] data = { &foo, &bar, &xx };
+private void*[3] data = { &foo, &bar, &xx };
 
-// #expect: const_pointer.ll
+/* #expect: const_pointer.ll
 
 @const_pointer.foo = protected global double 1.700000e+01, align 8
 @const_pointer.bar = protected global double 1.200000e+01, align 8
diff --git a/test/test_suite/strings/literal_to_subarray.c3t b/test/test_suite/strings/literal_to_subarray.c3t
index 00a40d72b..910e86abb 100644
--- a/test/test_suite/strings/literal_to_subarray.c3t
+++ b/test/test_suite/strings/literal_to_subarray.c3t
@@ -1,6 +1,6 @@
 // #target: x64-darwin
 
-global char[] y = "hello";
+char[] y = "hello";
 
 fn void test()
 {
diff --git a/test/test_suite/struct/simple_struct.c3t b/test/test_suite/struct/simple_struct.c3t
index 105ece5f5..fb5f5308a 100644
--- a/test/test_suite/struct/simple_struct.c3t
+++ b/test/test_suite/struct/simple_struct.c3t
@@ -1,6 +1,6 @@
 module test;
 
-private global Foo a;
+private Foo a;
 
 struct Foo
 {
diff --git a/test/test_suite/struct/struct_const_construct_simple.c3t b/test/test_suite/struct/struct_const_construct_simple.c3t
index af40acd7b..57041cfb2 100644
--- a/test/test_suite/struct/struct_const_construct_simple.c3t
+++ b/test/test_suite/struct/struct_const_construct_simple.c3t
@@ -6,16 +6,16 @@ struct Foo
     long bar;
 }
 
-private global usize x = $sizeof(Foo);
+private usize x = $sizeof(Foo);
 
-private global Foo foo1 = { 1, 2 };
-private global Foo foo2 = { .foo = 2 };
-private global Foo foo3 = { .bar = 3 };
-private global Foo foo4 = { .bar = 4, .foo = 4, .bar = 1 };
-private global Foo foo5 = {};
-private global Foo foo6;
+private Foo foo1 = { 1, 2 };
+private Foo foo2 = { .foo = 2 };
+private Foo foo3 = { .bar = 3 };
+private Foo foo4 = { .bar = 4, .foo = 4, .bar = 1 };
+private Foo foo5 = {};
+private Foo foo6;
 private const Foo FOO7 = { 1, 2 };
-private global Foo foo8 = FOO7;
+private Foo foo8 = FOO7;
 
 // #expect: structo.ll
 
diff --git a/test/test_suite/struct/struct_pack_and_align.c3t b/test/test_suite/struct/struct_pack_and_align.c3t
index d0fcb7fce..4983205e4 100644
--- a/test/test_suite/struct/struct_pack_and_align.c3t
+++ b/test/test_suite/struct/struct_pack_and_align.c3t
@@ -8,7 +8,7 @@ struct Foo1 @packed @align(4)
 }
 
 $assert($sizeof(Foo1) == 12);
-global Foo1 foo1 = { 1, 2 };
+Foo1 foo1 = { 1, 2 };
 
 // <{ i8, i64, [3 x i8] }>
 struct Foo2 @packed @align(4)
@@ -18,7 +18,7 @@ struct Foo2 @packed @align(4)
 }
 
 $assert($sizeof(Foo2) == 12);
-global Foo2 foo2 = { 1, 2 };
+Foo2 foo2 = { 1, 2 };
 
 // <{ i8, i64, [7 x i8] }>
 struct Foo3 @packed @align(8)
@@ -27,7 +27,7 @@ struct Foo3 @packed @align(8)
     long bar;
 }
 
-global Foo3 foo3 = { 1, 2 };
+Foo3 foo3 = { 1, 2 };
 $assert($sizeof(Foo3) == 16);
 
 // <{ i8, i64 }>
@@ -38,7 +38,7 @@ struct Foo4 @packed
 }
 
 $assert($sizeof(Foo4) == 9);
-global Foo4 foo4 = { 1, 2 };
+Foo4 foo4 = { 1, 2 };
 
 // { i32, [12 x i8], i8, [15 x i8] }
 struct Foo5
@@ -48,7 +48,7 @@ struct Foo5
 }
 
 $assert($sizeof(Foo5) == 32);
-global Foo5 foo5 = { 1, 2 };
+Foo5 foo5 = { 1, 2 };
 
 fn int test5(ichar x)
 {
@@ -65,7 +65,7 @@ struct Foo6 @packed
 }
 
 $assert($sizeof(Foo6) == 8);
-global Foo6 foo6 = { 1, 2, 3 };
+Foo6 foo6 = { 1, 2, 3 };
 
 // #expect: struct2.ll
 
diff --git a/test/test_suite/union/union_codegen_const.c3t b/test/test_suite/union/union_codegen_const.c3t
index fe8ea6235..a6c31cd2a 100644
--- a/test/test_suite/union/union_codegen_const.c3t
+++ b/test/test_suite/union/union_codegen_const.c3t
@@ -6,10 +6,10 @@ union Foo
     double b;
 }
 
-private global Foo f = { .a = 23 };
-private global Foo g = { .b = 2.3 };
-private global Foo h = { .a = 23, .b = 2.3 };
-global Foo i = { .b = 2.3, .a = 23 };
+private Foo f = { .a = 23 };
+private Foo g = { .b = 2.3 };
+private Foo h = { .a = 23, .b = 2.3 };
+Foo i = { .b = 2.3, .a = 23 };
 
 // #expect: test.ll
 
diff --git a/test/test_suite/union/union_in_struct.c3t b/test/test_suite/union/union_in_struct.c3t
index a57306d86..f654b57ee 100644
--- a/test/test_suite/union/union_in_struct.c3t
+++ b/test/test_suite/union/union_in_struct.c3t
@@ -11,8 +11,8 @@ struct Foo
     int z;
 }
 
-global Foo foo1 = { .a = 3, .z = 4 };
-global Foo foo2 = { .b = 3, .z = 4 };
+Foo foo1 = { .a = 3, .z = 4 };
+Foo foo2 = { .b = 3, .z = 4 };
 
 struct Blend_Map_Entry
 {
@@ -22,10 +22,10 @@ struct Blend_Map_Entry
   }
 }
 
-global Blend_Map_Entry a = { .vals = { .colour = { 1, 2, 3, 4, 5 } } };
-global Blend_Map_Entry b = { .vals = { .point_Slope = { 6, 7 } } };
-global Blend_Map_Entry c = { .vals.colour[2] = 1 };
-global Blend_Map_Entry d = { .vals.colour = { 1, 2, 3, 4, 5 } };
+Blend_Map_Entry a = { .vals = { .colour = { 1, 2, 3, 4, 5 } } };
+Blend_Map_Entry b = { .vals = { .point_Slope = { 6, 7 } } };
+Blend_Map_Entry c = { .vals.colour[2] = 1 };
+Blend_Map_Entry d = { .vals.colour = { 1, 2, 3, 4, 5 } };
 
 fn void test(Blend_Map_Entry* foo)
 {
diff --git a/test/test_suite/vector/vector_init.c3t b/test/test_suite/vector/vector_init.c3t
index c3dce2902..c3dc6d460 100644
--- a/test/test_suite/vector/vector_init.c3t
+++ b/test/test_suite/vector/vector_init.c3t
@@ -1,5 +1,5 @@
 // #target: x64-darwin
-global int[<4>] baz = { 1, 4, 5, 7 };
+int[<4>] baz = { 1, 4, 5, 7 };
 
 fn void main()
 {