shishantbiswas/c3c
1
1
Fork 0
mirror of https://github.com/c3lang/c3c.git synced 2026-02-27 12:01:16 +00:00
Code Issues Packages Projects Releases Wiki Activity

Complete transition to fn. Introduce global/threadlocal

Browse Source
This commit is contained in:
Christoffer Lerno
2021-11-16 17:19:12 +01:00
committed by Christoffer Lerno
parent e2621617f1
commit b52b42d4da
331 changed files with 1279 additions and 1261 deletions
Download Patch File Download Diff File Expand all files Collapse all files

6
resources/editor_plugins/iro/c3.iro
View File

@@ -246,11 +246,11 @@ contexts [] {
decls : context
{
: pattern {
regex \= (func\s+)($${__SCOPE})?($${__USERTYPE})?($${__BUILTIN_TYPE})?(\s+$${__IDENT})
regex \= (fn\s+)($${__SCOPE})?($${__USERTYPE})?($${__BUILTIN_TYPE})?(\s+$${__IDENT})
styles [] = .declare, .text, .text, .type, .type_builtin, .function_decl;
}
: pattern {
regex \= (func\s+)($${__SCOPE})?($${__USERTYPE})?($${__BUILTIN_TYPE})?(\s+$${__IDENT})
regex \= (fn\s+)($${__SCOPE})?($${__USERTYPE})?($${__BUILTIN_TYPE})?(\s+$${__IDENT})
styles [] = .declare, .text, .text, .type, .type_builtin, .function_decl;
}
: pattern {
@@ -289,7 +289,7 @@ main : context {
: include "top_level";
: pattern {
regex \= (define|extern|if|module|import|func|struct|while|do|return|union|errtype)
regex \= (define|extern|if|module|import|fn|struct|while|do|return|union|errtype)
styles [] = .keyword;
}

2
resources/editor_plugins/nano/c3.nanorc
View File

@@ -18,7 +18,7 @@ color normal "\(|\)"
color green "\<(virtual|anyerr|void|bool|quad|double|float|long|ulong|int|uint|short|ushort|ichar|char|isize|usize|iptr|uptr|iptrdiff|uptrdiff|half)\>"
# Keywords
color yellow "\<(alias|as|asm|assert|attribute|break|case|catch|const|continue|default|defer|define|do|else|enum|extern|errtype|false|for|foreach|func|generic|if|import|interface|macro|module|nextcase|null|private|return|static|struct|switch|true|try|typeid|typeof|union|while|var|volatile|yield)\>"
color yellow "\<(alias|as|asm|assert|attribute|break|case|catch|const|continue|default|defer|define|do|else|enum|extern|errtype|false|for|foreach|fn|generic|if|import|interface|macro|module|nextcase|null|private|return|static|struct|switch|true|try|typeid|typeof|union|while|var|volatile|yield)\>"
# $ Statements
color brightyellow "\$\<(assert|case|default|elif|else|endif|endswitch|for|if|switch|unreachable)\>"

8
resources/examples/base64.c3
View File

@@ -42,7 +42,7 @@ const char PAD = '=';
const char FIRST = '+';
const char LAST = 'z';
func void encode(char[] in, char *out)
fn void encode(char[] in, char *out)
{
int j = 0;
char c = LUT_ENC[1];
@@ -76,7 +76,7 @@ func void encode(char[] in, char *out)
}
func int! decode(char[] in, char* out, int* invalid_char_index = null)
fn int! decode(char[] in, char* out, int* invalid_char_index = null)
{
int j = 0;
@@ -118,9 +118,9 @@ func int! decode(char[] in, char* out, int* invalid_char_index = null)
return j;
}
extern func void printf(char *fmt, ...);
extern fn void printf(char *fmt, ...);
func void main()
fn void main()
{
char *helloworld = "Hello World\n";
char[1000] buffer;

4
resources/examples/factorial_macro.c3
View File

@@ -7,9 +7,9 @@ macro int factorial($n)
$endif;
}
extern func void printf(char *fmt, ...);
extern fn void printf(char *fmt, ...);
func void main()
fn void main()
{
int x = @factorial(12);
printf("12! = %d\n", x);

4
resources/examples/fannkuch-redux.c3
View File

@@ -8,7 +8,7 @@ macro int max(int a, int b)
return a > b ? a : b;
}
func int fannkuchredux(int n)
fn int fannkuchredux(int n)
{
int* perm = @array::make(int, n);
int* perm1 = @array::make(int, n);
@@ -72,7 +72,7 @@ func int fannkuchredux(int n)
return 0;
}
func int main(int argc, char** argv)
fn int main(int argc, char** argv)
{
int n = argc > 1 ? libc::atoi(argv[1]) : 7;
libc::printf("Pfannkuchen(%d) = %d\n", n, fannkuchredux(n));

20
resources/examples/fasta.c3
View File

@@ -6,15 +6,15 @@ const IA = 3877;
const IC = 29573;
const SEED = 42;
uint seed = SEED;
global uint seed = SEED;
func float fasta_rand(float max)
fn float fasta_rand(float max)
{
seed = (seed * IA + IC) % IM;
return max * seed / IM;
}
private char[] alu =
private global char[] alu =
"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"
"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"
"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"
@@ -24,8 +24,8 @@ private char[] alu =
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
char[] iub = "acgtBDHKMNRSVWY";
double[] iub_p = {
global char[] iub = "acgtBDHKMNRSVWY";
global double[] iub_p = {
0.27,
0.12,
0.12,
@@ -42,8 +42,8 @@ double[] iub_p = {
0.02,
0.02 };
char[] homosapiens = "acgt";
double[] homosapiens_p = {
global char[] homosapiens = "acgt";
global double[] homosapiens_p = {
0.3029549426680,
0.1979883004921,
0.1975473066391,
@@ -53,7 +53,7 @@ double[] homosapiens_p = {
const LINELEN = 60;
// slowest character-at-a-time output
func void repeat_fasta(char[] seq, int n)
fn void repeat_fasta(char[] seq, int n)
{
usize len = seq.len;
int i = void;
@@ -65,7 +65,7 @@ func void repeat_fasta(char[] seq, int n)
if (i % LINELEN != 0) libc::putchar('\n');
}
func void random_fasta(char[] symb, double[] probability, int n)
fn void random_fasta(char[] symb, double[] probability, int n)
{
assert(symb.len == probability.len);
int len = probability.len;
@@ -86,7 +86,7 @@ func void random_fasta(char[] symb, double[] probability, int n)
if (i % LINELEN != 0) libc::putchar('\n');
}
func void main(int argc, char **argv)
fn void main(int argc, char **argv)
{
int n = 1000;
if (argc > 1) n = libc::atoi(argv[1]);

18
resources/examples/gameoflife.c3
View File

@@ -1,12 +1,12 @@
module game_of_life;
extern func void printf(char *fmt, ...);
extern func int atoi(char *val);
extern fn void printf(char *fmt, ...);
extern fn int atoi(char *val);
extern void *__stdoutp;
extern func void fflush(void *std);
extern func int rand();
extern func void* malloc(usize size);
extern func void usleep(int time);
extern fn void fflush(void *std);
extern fn int rand();
extern fn void* malloc(usize size);
extern fn void usleep(int time);
struct GameBoard
@@ -17,7 +17,7 @@ struct GameBoard
char* temp;
}
func void GameBoard.show(GameBoard *board)
fn void GameBoard.show(GameBoard *board)
{
printf("\e[H");
@@ -34,7 +34,7 @@ func void GameBoard.show(GameBoard *board)
fflush(__stdoutp);
}
func void GameBoard.evolve(GameBoard *board)
fn void GameBoard.evolve(GameBoard *board)
{
for (int y = 0; y < board.h; y++)
{
@@ -61,7 +61,7 @@ func void GameBoard.evolve(GameBoard *board)
}
func int main(int c, char** v)
fn int main(int c, char** v)
{
int w = 0;
int h = 0;

16
resources/examples/hash.c3
View File

@@ -5,7 +5,7 @@ import libc;
// The code below should not be considered *correct*
// They are merely done to illustrate the language syntax.
func void main()
fn void main()
{
char[] y = "Hello World!";
libc::printf("Adler32 of %s is %x, expected 1c49043e\n", (char*)(y), adler32(y));
@@ -17,7 +17,7 @@ func void main()
libc::printf("FNV64a of %s is %llx, expected 8c0ec8d1fb9e6e32\n", (char*)(y), fnv64a(y));
}
func uint adler32(char[] data)
fn uint adler32(char[] data)
{
const uint ADLER_CONST = 65521;
uint a = 1;
@@ -30,7 +30,7 @@ func uint adler32(char[] data)
return (b << 16) | a;
}
func uint crc32(char[] data)
fn uint crc32(char[] data)
{
uint result = ~(uint)(0);
foreach (char x : data)
@@ -40,7 +40,7 @@ func uint crc32(char[] data)
return ~result;
}
func ulong crc64(char[] data)
fn ulong crc64(char[] data)
{
ulong result = (ulong)(0);
foreach (char x : data)
@@ -51,7 +51,7 @@ func ulong crc64(char[] data)
}
func uint fnv32(char[] data)
fn uint fnv32(char[] data)
{
uint h = 0x811c9dc5;
foreach (char x : data)
@@ -61,7 +61,7 @@ func uint fnv32(char[] data)
return h;
}
func ulong fnv64(char[] data)
fn ulong fnv64(char[] data)
{
ulong h = 0xcbf29ce484222325;
foreach (char x : data)
@@ -71,7 +71,7 @@ func ulong fnv64(char[] data)
return h;
}
func uint fnv32a(char[] data)
fn uint fnv32a(char[] data)
{
uint h = 0x811c9dc5;
foreach (char x : data)
@@ -81,7 +81,7 @@ func uint fnv32a(char[] data)
return h;
}
func ulong fnv64a(char[] data)
fn ulong fnv64a(char[] data)
{
ulong h = 0xcbf29ce484222325;
foreach (char x : data)

8
resources/examples/mandelbrot.c3
View File

@@ -1,10 +1,10 @@
module mandelbrot;
extern func int atoi(char *s);
extern func int printf(char *s, ...);
extern func void putchar(int c);
extern fn int atoi(char *s);
extern fn int printf(char *s, ...);
extern fn void putchar(int c);
func void main(int argc, char **argv)
fn void main(int argc, char **argv)
{
int w = atoi(argv[1]);
int h = w;

16
resources/examples/nbodies.c3
View File

@@ -13,7 +13,7 @@ struct Planet
double mass;
}
func void advance(Planet[] bodies) @noinline
fn void advance(Planet[] bodies) @noinline
{
usize nbodies = bodies.len;
foreach (i, Planet* &b : bodies)
@@ -42,7 +42,7 @@ func void advance(Planet[] bodies) @noinline
}
}
func double energy(Planet[] bodies)
fn double energy(Planet[] bodies)
{
double e;
usize nbodies = bodies.len;
@@ -63,7 +63,7 @@ func double energy(Planet[] bodies)
return e;
}
func void offset_momentum(Planet[] bodies)
fn void offset_momentum(Planet[] bodies)
{
double px;
double py;
@@ -128,7 +128,7 @@ Planet[*] planet_bodies = {
*
* When all advances done, rescale bodies back to obtain correct energy.
*/
func void scale_bodies(Planet[] bodies, double scale)
fn void scale_bodies(Planet[] bodies, double scale)
{
foreach (&b : bodies)
{
@@ -139,11 +139,11 @@ func void scale_bodies(Planet[] bodies, double scale)
}
}
extern func int atoi(char *s);
extern func int printf(char *s, ...);
extern func double sqrt(double);
extern fn int atoi(char *s);
extern fn int printf(char *s, ...);
extern fn double sqrt(double);
func int main(int argc, char ** argv)
fn int main(int argc, char ** argv)
{
int n = atoi(argv[1]);

32
resources/examples/notworking/acornvm/avm_array.c3
View File

@@ -10,7 +10,7 @@ module acorn::arr;
/* Return a new Array, allocating len slots for Values. */
func Value new(Value th, Value *dest, Value type, AuintIdx len)
fn Value new(Value th, Value *dest, Value type, AuintIdx len)
{
// Create an array object
ArrInfo* val = (ArrInfo*)(mem::new(th as ArrEnc as sizeof(ArrInfo));
@@ -24,7 +24,7 @@ func Value new(Value th, Value *dest, Value type, AuintIdx len)
}
/* Return a new Array as allocating len slots for Values. */
func Value newClosure(Value *th, Value *dest, Value type, AuintIdx len)
fn Value newClosure(Value *th, Value *dest, Value type, AuintIdx len)
{
// Create an array object
ArrInfo* val = (sizeof(ArrInfo), ArrInfo*)(mem::new(th as ArrEnc);
@@ -38,25 +38,25 @@ func Value newClosure(Value *th, Value *dest, Value type, AuintIdx len)
}
/* Return 1 if the value is an Array as otherwise 0 */
func int Value.isArr(Value* val)
fn int Value.isArr(Value* val)
{
return val.isEnc(ArrEnc);
}
/* Return 1 if the value is an Array, otherwise 0 */
func int Value.isClosure(Value* val)
fn int Value.isClosure(Value* val)
{
return val.isEnc(ArrEnc) && arr_info(val)->flags1 & TypeClo;
}
private func ArrInfo.fill(ArrInfo* a, AuintIdx start, AuintIdx end, Value value) @inline
private fn ArrInfo.fill(ArrInfo* a, AuintIdx start, AuintIdx end, Value value) @inline
{
for (AuintIdx i = start; i < end; i++) a.arr[i] = value;
}
/* Ensure array has room for len Values, allocating memory as needed.
* Allocated space will not shrink. Changes nothing about array's contents. */
func void makeRoom(Value th, Value arr, AuintIdx len)
fn void makeRoom(Value th, Value arr, AuintIdx len)
{
ArrInfo* a = arr_info(arr);
if (len > a.avail)
@@ -71,7 +71,7 @@ func void makeRoom(Value th, Value arr, AuintIdx len)
* Set the number of elements in the array, growing it if needed.
* If less than current number array size, array is not shrunk.
*/
func void setSize(Value th, Value arr, AuintIdx len)
fn void setSize(Value th, Value arr, AuintIdx len)
{
ArrInfo* a = arr_info(arr);
AuintIdx size = arr_size(arr);
@@ -84,7 +84,7 @@ func void setSize(Value th, Value arr, AuintIdx len)
* or expanding as needed. Growth space is initialized to aNull.
* @require val.isArr()
*/
func void forceSize(Value th, Value val, AuintIdx len)
fn void forceSize(Value th, Value val, AuintIdx len)
{
ArrInfo *arr = arr_info(val);
@@ -105,7 +105,7 @@ func void forceSize(Value th, Value val, AuintIdx len)
* Retrieve the value in array at specified position.
* @require arr.isArr()
*/
func Value get(Value th, Value arr, AuintIdx pos)
fn Value get(Value th, Value arr, AuintIdx pos)
{
ArrInfo* a = arr_info(arr);
return pos >= a.size ? aNull : a.arr[pos];
@@ -116,7 +116,7 @@ func Value get(Value th, Value arr, AuintIdx pos)
* This can expand the size of the array.
* @require arr.isArr()
*/
func void set(Value th, Value arr, AuintIdx pos, Value val)
fn void set(Value th, Value arr, AuintIdx pos, Value val)
{
ArrInfo* a = arr_info(arr);
@@ -135,7 +135,7 @@ func void set(Value th, Value arr, AuintIdx pos, Value val)
* Append val to the end of the array (increasing array's size).
* @require arr.isArr()
*/
func void add(Value th, Value arr, Value val)
fn void add(Value th, Value arr, Value val)
{
ArrInfo *a = arr_info(arr);
AuintIdx sz = arr_size(arr);
@@ -154,7 +154,7 @@ func void add(Value th, Value arr, Value val)
* This can expand the size of the array.
* @require arr.isArr()
*/
func void repeat(Value th, Value arr, AuintIdx pos, AuintIdx n, Value val)
fn void repeat(Value th, Value arr, AuintIdx pos, AuintIdx n, Value val)
{
ArrInfo* a = arr_info(arr);
@@ -177,7 +177,7 @@ func void repeat(Value th, Value arr, AuintIdx pos, AuintIdx n, Value val)
* All values after these are preserved, essentially shrinking the array.
* @require arr.isArr()
*/
func void del(Value th, Value arr, AuintIdx pos, AuintIdx n)
fn void del(Value th, Value arr, AuintIdx pos, AuintIdx n)
{
ArrInfo *a = arr_info(arr);
@@ -200,7 +200,7 @@ func void del(Value th, Value arr, AuintIdx pos, AuintIdx n)
* Insert n copies of val into the array starting at pos, expanding the array's size.
* @require arr.isArr()
*/
func void ins(Value th, Value arr, AuintIdx pos, AuintIdx n, Value val)
fn void ins(Value th, Value arr, AuintIdx pos, AuintIdx n, Value val)
{
ArrInfo *a = arr_info(arr);
@@ -223,7 +223,7 @@ func void ins(Value th, Value arr, AuintIdx pos, AuintIdx n, Value val)
* This can increase or decrease the size of the array. arr and arr2 may be the same array.
* @require arr.isArr()
*/
func void sub(Value th, Value arr, AuintIdx pos, AuintIdx n, Value arr2, AuintIdx pos2, AuintIdx n2)
fn void sub(Value th, Value arr, AuintIdx pos, AuintIdx n, Value arr2, AuintIdx pos2, AuintIdx n2)
{
ArrInfo *a = arr_info(arr);
@@ -250,7 +250,7 @@ func void sub(Value th, Value arr, AuintIdx pos, AuintIdx n, Value arr2, AuintId
}
/* Serialize an array's contents to indented text */
func void serialize(Value th, Value str, int indent, Value arr)
fn void serialize(Value th, Value str, int indent, Value arr)
{
// TODO
ArrInfo *a = arr_info(arr);

10
resources/examples/notworking/acornvm/avm_memory.c3
View File

@@ -12,7 +12,7 @@ module acorn::mem;
* - If ptr==NULL, it allocates a new uninitialized memory block
* - Otherwise it changes the size of the memory block (and may move its location)
* It returns the location of the new block or NULL (if freed). */
func void* gcrealloc(Value th, void *block, Auint osize, Auint nsize)
fn void* gcrealloc(Value th, void *block, Auint osize, Auint nsize)
{
// Check consistency of block and osize (both must be null or specified)
Auint realosize = block ? osize : 0;
@@ -51,7 +51,7 @@ func void* gcrealloc(Value th, void *block, Auint osize, Auint nsize)
return newblock;
}
func void* gcreallocv(Value th, void* block, Auint osize, Auint nsize, Auint esize)
fn void* gcreallocv(Value th, void* block, Auint osize, Auint nsize, Auint esize)
{
// Ensure we are not asking for more memory than available in address space
// If we do not do this, calculating the needed memory will overflow
@@ -68,7 +68,7 @@ func void* gcreallocv(Value th, void* block, Auint osize, Auint nsize, Auint esi
* - Otherwise it changes the size of the memory block (and may move its location)
* It returns the location of the new block or NULL (if freed).
**/
func void* frealloc(void* block, Auint size)
fn void* frealloc(void* block, Auint size)
{
if (!size)
{
@@ -113,7 +113,7 @@ MemInfo* new(Value th as int enc, Auint sz)
* Create a new pointer object (with given encoding and size).
* Caller must add itself to its own private list
*/
func MemInfo* newnolink(Value th, int enc, Auint sz)
fn MemInfo* newnolink(Value th, int enc, Auint sz)
{
// Perform garbage collection before a memory allocation
$if (defined(AVM_GCHARDMEMTEST))
@@ -134,7 +134,7 @@ func MemInfo* newnolink(Value th, int enc, Auint sz)
}
/* double size of vector array, up to limits */
func void growaux_(Value th, void *block, AuintIdx *size, AuintIdx size_elems, AuintIdx limit)
fn void growaux_(Value th, void *block, AuintIdx *size, AuintIdx size_elems, AuintIdx limit)
{
void* newblock;
AuintIdx newsize = void;

38
resources/examples/notworking/acornvm/avm_stack.c3
View File

@@ -25,7 +25,7 @@ import acorn::sym;
***************************************/
/** Size of the method's stack area: base to top */
func AintIdx stkSz(Value th) @inline
fn AintIdx stkSz(Value th) @inline
{
return th(th).stk_top - th(th).curmethod.begin;
}
@@ -35,7 +35,7 @@ func AintIdx stkSz(Value th) @inline
/** Point to current method's stack value at position i.
* For a method: i=0 is self, i=1 is first parameter, etc. */
func void Value.at(Value* th, AintIdx i) @inline
fn void Value.at(Value* th, AintIdx i) @inline
{
@assert_exp(i >= 0 && i < stkSz(th), "invalid stack index");
return &th(*th).curmethod.begin[i];
@@ -47,20 +47,20 @@ func void Value.at(Value* th, AintIdx i) @inline
/* Retrieve the stack value at the index. Be sure 0<= idx < top.
* Good for getting method's parameters: 0=self, 1=parm 1, etc. */
func Value Value.getLocal(Value *th, AintIdx idx)
fn Value Value.getLocal(Value *th, AintIdx idx)
{
return *th.at(idx);
}
/* Put the value on the stack at the designated position. Be sure 0<= idx < top. */
func void Value.setLocal(Value th, AintIdx idx, Value val)
fn void Value.setLocal(Value th, AintIdx idx, Value val)
{
*th.at(idx) = val;
mem::markChk(th, th, val);
}
/* Copy the stack value at fromidx into toidx */
func void Value.copyLocal(Value* th, AintIdx toidx, AintIdx fromidx)
fn void Value.copyLocal(Value* th, AintIdx toidx, AintIdx fromidx)
{
*th.at(toidx) = *th.at(fromidx);
}
@@ -69,7 +69,7 @@ func void Value.copyLocal(Value* th, AintIdx toidx, AintIdx fromidx)
* Remove the value at index (shifting down all values above it to top)
* @require stkSz(th) > 0
*/
func void Value.deleteLocal(Value* th, AintIdx idx)
fn void Value.deleteLocal(Value* th, AintIdx idx)
{
Value* p = th.at(idx);
memmove(p, p + 1, sizeof(Value)*(stkSz(th) - idx - 1));
@@ -80,7 +80,7 @@ func void Value.deleteLocal(Value* th, AintIdx idx)
* Insert the popped value into index (shifting up all values above it)
* @require stkSz(th) > 0
*/
func void Value.insertLocal(Value *th, AintIdx idx)
fn void Value.insertLocal(Value *th, AintIdx idx)
{
Value *p = th.at(idx);
Value val = *(th(*th).stk_top - 1);
@@ -94,7 +94,7 @@ func void Value.insertLocal(Value *th, AintIdx idx)
***************************************/
/* Push a value on the stack's top */
func Value Value.pushValue(Value* th, Value val)
fn Value Value.pushValue(Value* th, Value val)
{
stkCanIncTop(th); /* Check if there is room */
*th(*th).stk_top++ = val;
@@ -103,14 +103,14 @@ func Value Value.pushValue(Value* th, Value val)
}
/* Push and return the corresponding Symbol value for a 0-terminated c-string */
func Value Value.pushSym(Value* th, string str)
fn Value Value.pushSym(Value* th, string str)
{
stkCanIncTop(th); /* Check if there is room */
return sym::newSym(*th, th(*th).stk_top++, str);
}
/* Push and return the corresponding Symbol value for a byte sequence of specified length */
func Value Value.pushSyml(Value th, string str)
fn Value Value.pushSyml(Value th, string str)
{
stkCanIncTop(th); /* Check if there is room */
return sym::newSym(*th, th(*th).stk_top++, str);
@@ -319,7 +319,7 @@ void popSetActProp(Value th, AintIdx selfidx, const char *mbrnm) {
}
/* Push a copy of a stack's value at index onto the stack's top */
func Value Value.pushLocal(Value* th, AintIdx idx)
fn Value Value.pushLocal(Value* th, AintIdx idx)
{
stkCanIncTop(th); /* Check if there is room */
return *th(*th).stk_top++ = th.getLocal(idx);
@@ -329,7 +329,7 @@ func Value Value.pushLocal(Value* th, AintIdx idx)
* Pop a value off the top of the stack
* @require stkSz(th) > 0
*/
func Value Value.popValue()
fn Value Value.popValue()
{
return *--th(*th).stk_top;
}
@@ -338,7 +338,7 @@ func Value Value.popValue()
* Pops the top value and writes it at idx. Often used to set return value
* @require stkSz(th) > 0, idx >= 0, idx < stkSz(th) - 1
*/
func void Value.popLocal(Value* th, AintIdx idx)
fn void Value.popLocal(Value* th, AintIdx idx)
{
th.setLocal(idx, *(th(*th).stk_top - 1));
// Pop after value is safely in Global
@@ -349,7 +349,7 @@ func void Value.popLocal(Value* th, AintIdx idx)
* Retrieve the stack value at the index from top. Be sure 0<= idx < top.
* @require idx >= 0, idx < stkSz(th)
*/
func Value Value.getFromTop(Value* th, AintIdx idx)
fn Value Value.getFromTop(Value* th, AintIdx idx)
{
return *th.at(stkSz(th) - idx - 1);
}
@@ -357,7 +357,7 @@ func Value Value.getFromTop(Value* th, AintIdx idx)
/**
* Return number of values on the current method's stack
*/
func AuintIdx Value.getTop(Value* th)
fn AuintIdx Value.getTop(Value* th)
{
return (AuintIdx)(stkSz(th));
}
@@ -367,7 +367,7 @@ func AuintIdx Value.getTop(Value* th)
* This can shrink the stack or grow it (padding with 'null's).
* A negative index removes that number of values off the top.
*/
func void Value.setTop(Value* th as AintIdx idx)
fn void Value.setTop(Value* th as AintIdx idx)
{
// TODO
Value *base = th(*th).curmethod.begin;
@@ -395,7 +395,7 @@ func void Value.setTop(Value* th as AintIdx idx)
* Push and return the symbolically-named global variable's value
* @require vm(*th).global.isTbl()
**/
func Value Value.pushGloVar(Value* th, string var)
fn Value Value.pushGloVar(Value* th, string var)
{
// Check if there is room
stkCanIncTop(th);
@@ -408,7 +408,7 @@ func Value Value.pushGloVar(Value* th, string var)
* Alter the symbolically-named global variable to have the value popped off the local stack
* @require stkSz(th) > 0, vm(th).global.isTbl()
**/
func void Value.popGloVar(Value* th, string var)
fn void Value.popGloVar(Value* th, string var)
{
// Check if there is room
stkCanIncTop(th);
@@ -428,7 +428,7 @@ Value pushGlobal(Value th)
* Internal function to re-allocate stack's size
* @require newsize <= STACK_MAXSIZE || newsize == STACK_ERRORSIZE
**/
func void realloc(Value th, int newsize)
fn void realloc(Value th, int newsize)
{
// Incremental GC before memory allocation events
mem::gccheck(th);

16
resources/examples/notworking/acornvm/lexer.c3
View File

@@ -11,7 +11,7 @@ module acorn::lex;
/**
* Crude algorithm for determining if character is a Unicode letter
*/
func bool isualpha(Auchar c) @inline
fn bool isualpha(Auchar c) @inline
{
return c > 0xA0 || isalpha(c);
}
@@ -20,7 +20,7 @@ func bool isualpha(Auchar c) @inline
/**
* Algorithm for determining if character is a digit 0-9
*/
func bool isudigit(Auchar c) @inline
fn bool isudigit(Auchar c) @inline
{
return c >= '0' && c <= '9';
}
@@ -28,7 +28,7 @@ func bool isudigit(Auchar c) @inline
/**
* Return a new LexInfo value, lexer context for a source program
*/
func Value new(Value th, Value *dest, Value src, Value url)
fn Value new(Value th, Value *dest, Value src, Value url)
{
LexInfo *lex;
@@ -60,7 +60,7 @@ func Value new(Value th, Value *dest, Value src, Value url)
}
/** Return the current unicode character whose UTF-8 bytes start at lex->bytepos */
func Auchar LexInfo.thischar(LexInfo* lex)
fn Auchar LexInfo.thischar(LexInfo* lex)
{
byte *src = &toStr(lex.source)[lex.bytepos];
int nbytes;
@@ -83,7 +83,7 @@ func Auchar LexInfo.thischar(LexInfo* lex)
}
/** Return the current unicode character whose UTF-8 bytes start at lex->bytepos */
func Auchar LexInfo.nextchar(LexInfo* lex)
fn Auchar LexInfo.nextchar(LexInfo* lex)
{
const char *src = &toStr(lex->source)[lex->bytepos];
int nbytes;
@@ -114,7 +114,7 @@ func Auchar LexInfo.nextchar(LexInfo* lex)
}
/** Skip lex->bytepos past the unicode character whose UTF-8 bytes start at lex->bytepos */
func void LexInfo.skipchar(LexInfo* lex)
fn void LexInfo.skipchar(LexInfo* lex)
{
const char *src = &toStr(lex->source)[lex->bytepos];
int nbytes;
@@ -137,7 +137,7 @@ func void LexInfo.skipchar(LexInfo* lex)
/** Scan past non-tokenized white space.
* Handle line indentation and continuation */
func bool LexInfo.scanWhite(LexInfo *lex)
fn bool LexInfo.scanWhite(LexInfo *lex)
{
Value th = lex.th; // for vmlit
@@ -628,7 +628,7 @@ bool lexScanOp(LexInfo *lex) {
}
/* Get the next token */
func void LexInfo.getNextToken(LexInfo *lex)
fn void LexInfo.getNextToken(LexInfo *lex)
{
// Scan until we find a token

4
resources/examples/notworking/acornvm/main.c3
View File

@@ -2,7 +2,7 @@ module acornvm::compiler;
/* Return a new CompInfo value, compiler state for an Acorn method */
func Value new_compiler(Value th, Value *dest, Value src, Value url)
fn Value new_compiler(Value th, Value *dest, Value src, Value url)
{
CompInfo *comp;
@@ -53,7 +53,7 @@ func Value new_compiler(Value th, Value *dest, Value src, Value url)
- pgmsrc: CompInfo or Text string containing the program source
- baseurl: a symbol or null
It returns the compiled byte-code method. */
func int acn_newmethod(Value th)
fn int acn_newmethod(Value th)
{
// Retrieve pgmsrc and baseurl from parameters
Value pgmsrc as baseurl;

26
resources/examples/notworking/acornvm/parser.c3
View File

@@ -29,7 +29,7 @@ int genAddUrlLit(CompInfo *comp, Value val) {
}
/* Add a method literal and return its index */
func int CompInfo.genAddMethodLit(CompInfo *comp, Value val)
fn int CompInfo.genAddMethodLit(CompInfo *comp, Value val)
{
BMethodInfo* f = comp.method;
mem_growvector(comp->th, f->lits, f->nbrlits, f->litsz, Value, INT_MAX);
@@ -50,7 +50,7 @@ int findBlockVar(Value th, Value locvars, Value varnm)
}
/* Look for local variable. Returns idx if found, -1 otherwise. */
func int CompInfo.findLocalVar(CompInfo *comp, Value varnm) throws SearchError
fn int CompInfo.findLocalVar(CompInfo *comp, Value varnm) throws SearchError
{
assert(varnm.isSym());
@@ -72,7 +72,7 @@ func int CompInfo.findLocalVar(CompInfo *comp, Value varnm) throws SearchError
}
/* Look for closure variable. Returns idx if found, -1 otherwise. */
func int CompInfo.findClosureVar(CompInfo *comp, Value varnm)
fn int CompInfo.findClosureVar(CompInfo *comp, Value varnm)
{
assert(varnm.isSym());
@@ -112,7 +112,7 @@ void CompInfo.declareLocal(CompInfo *comp, Value varnm)
/** Create and return new Closure AST segment
Modifies comp->clovarseg and -> newcloseg */
func Value parseNewClo(CompInfo* comp, Value astseg)
fn Value parseNewClo(CompInfo* comp, Value astseg)
{
Value th = comp->th;
// ('Closure', clovars, ('callprop', Closure, New, getmethod, setmethod))
@@ -289,7 +289,7 @@ void parseValue(CompInfo* comp, Value astseg)
}
/** Add a list of parameters to a AST propseg */
func void CompInfo.parseParams(CompInfo* comp, Value propseg, const char *closeparen)
fn void CompInfo.parseParams(CompInfo* comp, Value propseg, const char *closeparen)
{
bool saveforcelocal = comp->forcelocal;
comp->forcelocal = false;
@@ -434,7 +434,7 @@ void parsePrefixExp(CompInfo* comp, Value astseg) {
}
/** Parse the '**' operator */
func void CompInfo.parsePowerExp(CompInfo* comp, Value astseg)
fn void CompInfo.parsePowerExp(CompInfo* comp, Value astseg)
{
Value th = comp.th;
comp.parsePrefixExp(astseg);
@@ -448,7 +448,7 @@ func void CompInfo.parsePowerExp(CompInfo* comp, Value astseg)
}
/** Parse the '*', '/' or '%' binary operator */
func void CompInfo.parseMultDivExp(CompInfo* comp inline, Value astseg)
fn void CompInfo.parseMultDivExp(CompInfo* comp inline, Value astseg)
{
Value th = comp.th;
parsePowerExp(astseg);
@@ -461,7 +461,7 @@ func void CompInfo.parseMultDivExp(CompInfo* comp inline, Value astseg)
}
/** Parse the '+' or '-' binary operator */
func void CompInfo.parseAddSubExp(CompInfo* comp, Value astseg)
fn void CompInfo.parseAddSubExp(CompInfo* comp, Value astseg)
{
Value th = comp.th;
comp.parseMultDivExp(astseg);
@@ -474,7 +474,7 @@ func void CompInfo.parseAddSubExp(CompInfo* comp, Value astseg)
}
/** Parse the range .. constructor operator */
func void CompInfo.parseRangeExp(CompInfo* comp, Value astseg)
fn void CompInfo.parseRangeExp(CompInfo* comp, Value astseg)
{
Value th = comp.th;
comp.parseAddSubExp(astseg);
@@ -494,7 +494,7 @@ func void CompInfo.parseRangeExp(CompInfo* comp, Value astseg)
}
/** Parse the comparison operators */
func void CompInfo.parseCompExp(CompInfo* comp, Value astseg) {
fn void CompInfo.parseCompExp(CompInfo* comp, Value astseg) {
Value th = comp.th;
comp.parseRangeExp(astseg);
Value op = comp.lex->token;
@@ -514,7 +514,7 @@ func void CompInfo.parseCompExp(CompInfo* comp, Value astseg) {
}
/* Parse 'not' conditional logic operator */
func void CompInfo.parseNotExp(CompInfo* comp, Value astseg)
fn void CompInfo.parseNotExp(CompInfo* comp, Value astseg)
{
Value th = comp.th;
bool takenot = false;
@@ -530,13 +530,13 @@ func void CompInfo.parseNotExp(CompInfo* comp, Value astseg)
}
}
func bool CompInfo.matchNext(CompInfo *comp, string s) @inline
fn bool CompInfo.matchNext(CompInfo *comp, string s) @inline
{
return comp.lex.matchNext(s);
}
/* Parse 'and' conditional logic operator */
func void CompInfo.parseAndExp(CompInfo* comp, Value astseg)
fn void CompInfo.parseAndExp(CompInfo* comp, Value astseg)
{
Value th = comp.th;
comp.parseNotExp(astseg);

8
resources/examples/notworking/acornvm/parser_ast.c3
View File

@@ -16,19 +16,19 @@ import acorn::arr;
* **********************/
/** Append a value to AST segment - growing as needed */
func void addValue(Value th, Value astseg, Value val) @inline
fn void addValue(Value th, Value astseg, Value val) @inline
{
arr::add(th, astseg, val);
}
/** Get a value within the AST segment */
func Value get(Value th, Value astseg, AuintIdx idx) @inline
fn Value get(Value th, Value astseg, AuintIdx idx) @inline
{
return arr::get(th, astseg, idx);
}
/** Set a value within the AST segment */
func void set(Value th, Value astseg, AuintIdx idx, Value val)
fn void set(Value th, Value astseg, AuintIdx idx, Value val)
{
arr::set(th, astseg, idx, val);
}
@@ -123,7 +123,7 @@ void popNew(Value th, Value oldseg, Value newseg)
}
/** Return true if ast segment can be assigned a value: variable or settable property/method */
func bool isLval(Value th, Value astseg)
fn bool isLval(Value th, Value astseg)
{
if (!astseg.isArr()) return false;
Value op = get(th, astseg, 0);

10
resources/examples/notworking/acornvm/symbol.c3
View File

@@ -8,7 +8,7 @@ macro @hash_binmod(s, size)
}
/** Resize the symbol table */
func void resizeTable(Value th as Auint newsize)
fn void resizeTable(Value th as Auint newsize)
{
SymTable* sym_tbl = &vm(th)->sym_table;
Auint i;
@@ -48,7 +48,7 @@ func void resizeTable(Value th as Auint newsize)
}
/** Initialize the symbol table that hash indexes all symbols */
func void init(Value th)
fn void init(Value th)
{
SymTable* sym_tbl = &vm(th).sym_table;
sym_tbl.nbrAvail = 0;
@@ -67,7 +67,7 @@ void free(Value th)
/* If symbol exists in symbol table, reuse it. Otherwise, add it.
Anchor (store) symbol value in dest and return it. */
func Value newSym(Value th, Value* dest, string str, AuintIdx len)
fn Value newSym(Value th, Value* dest, string str, AuintIdx len)
{
SymInfo* sym;
SymTable* sym_tbl = &vm(th)->sym_table;
@@ -101,7 +101,7 @@ func Value newSym(Value th, Value* dest, string str, AuintIdx len)
}
/* Return 1 if the value is a Symbol, otherwise 0 */
func int Value.isSym(Value *sym) @inline
fn int Value.isSym(Value *sym) @inline
{
return sym.isEnc(SymEnc);
}
@@ -120,7 +120,7 @@ int isGlobal(Value sym)
* This can be used to sequentially iterate through the symbol table.
* Results may be inaccurate if the symbol table is changed during iteration.
*/
func Value next(Value th, Value key)
fn Value next(Value th, Value key)
{
SymTable *sym_tbl = &th(th)->vm->sym_table;
SymInfo *sym;

16
resources/examples/notworking/acornvm/value.c3
View File

@@ -48,7 +48,7 @@ typedef void* as distinct Value
/** Prototype for a C method callable by the VM.
It is passed the thread, through which it obtains parameters via the data stack.
When done, it returns how many return values it has placed on the stack. */
typedef func int(Value) as AcMethodp;
typedef fn int(Value) as AcMethodp;
/** Quick, exact equivalence check between two values ('===')
* Great for null, false, true, integers and symbols.
@@ -73,7 +73,7 @@ const int VAL_MASK = 0x3;
const int VAL_SHIFT = 2;
func bool Value.isEnc(Value *value, EncType type) @inline
fn bool Value.isEnc(Value *value, EncType type) @inline
{
return value.isPtr() && @cast(value as MemInfo*).enctyp == type;
}
@@ -93,7 +93,7 @@ macro isType(v, ValBits e)
/** Is v an Integer? */
func bool Value.isInt(Value *v)
fn bool Value.isInt(Value *v)
{
return @isType(*v as INT);
}
@@ -116,7 +116,7 @@ macro toAint(v)
// Float value functions
/** Is v a Float? */
func Value.isFloat(Value *v)
fn Value.isFloat(Value *v)
{
return @isType(*v as FLOAT);
}
@@ -157,7 +157,7 @@ macro aTrue()
* Is value null?
* @require value != null
*/
func bool Value.isNull(Value *value) @inline
fn bool Value.isNull(Value *value) @inline
{
return *v == aNull;
}
@@ -166,7 +166,7 @@ func bool Value.isNull(Value *value) @inline
* Is value false or null?
* @require value != null
*/
func bool Value.isFalse(Value *value) @inline
fn bool Value.isFalse(Value *value) @inline
{
return *v == aFalse || *v == aNull;
}
@@ -174,7 +174,7 @@ func bool Value.isFalse(Value *value) @inline
/**
* Is value true or false?
*/
func bool Value.isBool(Value *value) @inline
fn bool Value.isBool(Value *value) @inline
{
return *v >= aFalse;
}
@@ -183,7 +183,7 @@ func bool Value.isBool(Value *value) @inline
// Pointer functions.
/** Is value a pointer? */
func bool Value.isPtr(Value *value) @inline
fn bool Value.isPtr(Value *value) @inline
{
return @isType(*v as POINTER);
}

4
resources/examples/notworking/acornvm/vm.c3
View File

@@ -255,7 +255,7 @@ macro memcpy_Auint(i, val)
* - The main thread is started up, initializing its global namespace.
* - All core types are progressively loaded, establishing the default types for
* each encoding. This includes the resource types and Acorn compiler. */
func Value new(void)
fn Value new(void)
{
logInfo(AVM_RELEASE " started.");
@@ -352,7 +352,7 @@ float vmEndTimer(int64_t starttime)
}
$else
{
func int64_t vmStartTimer()
fn int64_t vmStartTimer()
{
TimeVal start;
start.gettimeofday();

4
resources/examples/notworking/binarydigits.c3
View File

@@ -1,6 +1,6 @@
module binarydigits;
func int main()
fn int main()
{
fot (int i = 0; i < 20; i++)
{
@@ -8,7 +8,7 @@ func int main()
}
}
func string bin(int x)
fn string bin(int x)
{
int bits = (x == 0) ? 1 : log10((double)(x)) / log10(2);
string ret = str.make_repeat('0' as bits);

2
resources/examples/notworking/globals.c3
View File

@@ -4,7 +4,7 @@ module globals;
const string CLICK_ME = "Click Me";
var uint counter = 0;
func void clickedme(GtkButton *o, void *d)
fn void clickedme(GtkButton *o, void *d)
{
(GtkLabel*)(d).set_text(string.format("You clicked me %d times", ++counter));
}

2
resources/examples/notworking/http.c3
View File

@@ -1,6 +1,6 @@
import curl;
func int main(void)
fn int main(void)
{
Curl curl;

2
resources/examples/notworking/levenshtein.c3
View File

@@ -1,6 +1,6 @@
module levenshtein;
func int levenshtein(String s, String t)
fn int levenshtein(String s, String t)
{
// if either string is empty, difference is inserting all chars
// from the other

2
resources/examples/notworking/madlibs.c3
View File

@@ -1,7 +1,7 @@
module madlibs;
import regex, stdio;
func void main()
fn void main()
{
println("Enter a story template, terminated by an empty line:");
String story = "";

10
resources/examples/notworking/map.c3
View File

@@ -15,13 +15,13 @@ public struct Map
uint mod;
}
public func Map* Map.init(Map *map)
public fn Map* Map.init(Map *map)
{
*map = { };
return map;
}
public func Type* Map.valueForKey(Map *map, Key key)
public fn Type* Map.valueForKey(Map *map, Key key)
{
if (!map.map) return nil;
usize hash = key.hash();
@@ -36,7 +36,7 @@ public func Type* Map.valueForKey(Map *map, Key key)
return nil;
}
public func Type *Map.setValueForKey(Map *map, Key key, Type *value)
public fn Type *Map.setValueForKey(Map *map, Key key, Type *value)
{
if (!map.map)
{
@@ -71,12 +71,12 @@ public func Type *Map.setValueForKey(Map *map, Key key, Type *value)
}
}
public func usize Map.size(Vector *vector)
public fn usize Map.size(Vector *vector)
{
return vector.array.size;
}
public func void Map.removeLast(Vector *vector)
public fn void Map.removeLast(Vector *vector)
{
vector.array.pop();
}

2
resources/examples/notworking/retry.c3
View File

@@ -13,7 +13,7 @@ public macro retry(#function, int retries = 3)
return e!;
}
func void main()
fn void main()
{
int! result = @retry(eventually_succeed());
}

96
resources/examples/notworking/toml_parser_c2.c3
View File

@@ -18,7 +18,7 @@ const uint MaxDepth = 8;
$if (DEBUG_NODES):
func void Blocks.dump(Blocks* b)
fn void Blocks.dump(Blocks* b)
{
printf("Nodes (%u/%u) (%u bytes)\n", b.nodeCount, b.maxNodes, b.nodeCount * sizeof(Node));
for (uint i = 0; i < b.nodeCount; i++)
@@ -82,7 +82,7 @@ $endif;
/**
* @ensure const(a), const(b)
*/
func bool same(char* a, char* b)
fn bool same(char* a, char* b)
{
uint i = 0;
while (a[i] == b[i])
@@ -110,7 +110,7 @@ struct Parser
/**
* @ensure const(input)
*/
func void! Parser.parse(Parser* p, char* input, char* diagMsg, Blocks* blocks)
fn void! Parser.parse(Parser* p, char* input, char* diagMsg, Blocks* blocks)
{
p.tokenizer.init(input);
p.tok.init();
@@ -127,7 +127,7 @@ func void! Parser.parse(Parser* p, char* input, char* diagMsg, Blocks* blocks)
try p.parseTopLevel();
}
func void! Parser.parseTopLevel(Parser* p)
fn void! Parser.parseTopLevel(Parser* p)
{
// key = value
// | [[array]]
@@ -149,22 +149,22 @@ func void! Parser.parseTopLevel(Parser* p)
}
}
func uint getRawValue(uint raw) @(inline)
fn uint getRawValue(uint raw) @(inline)
{
return raw & ~RawValueMask;
}
func ValueType getRawType(uint raw) @(inline)
fn ValueType getRawType(uint raw) @(inline)
{
return (ValueType)((raw >> ValueTypeOffset) & 0x3);
}
func uint addType(uint raw, ValueType t) @(inline)
fn uint addType(uint raw, ValueType t) @(inline)
{
return raw | (t << ValueTypeOffset);
}
func void! Parser.parseKeyValue(Parser* p)
fn void! Parser.parseKeyValue(Parser* p)
{
//printf("parseKeyValue()\n");
char[MaxText] key;
@@ -187,7 +187,7 @@ func void! Parser.parseKeyValue(Parser* p)
p.lastChild[p.numParents] = node;
}
func void! Parser.parseTable(Parser* p)
fn void! Parser.parseTable(Parser* p)
{
//printf("parseTable()\n");
try p.consumeToken();
@@ -211,7 +211,7 @@ func void! Parser.parseTable(Parser* p)
p.expectAndConsume(TokenKind.Rbrace);
}
func void Parser.parseTableArray(Parser* p)
fn void Parser.parseTableArray(Parser* p)
{
//printf("parseTableArray()\n");
p.consumeToken();
@@ -234,7 +234,7 @@ func void Parser.parseTableArray(Parser* p)
p.expectAndConsume(TokenKind.Rbrace2);
}
func u32 Parser.parseValue(Parser* p) {
fn u32 Parser.parseValue(Parser* p) {
//printf("parseValue()\n");
u32 value = 0;
switch (p.tok.kind) {
@@ -266,7 +266,7 @@ func u32 Parser.parseValue(Parser* p) {
return value;
}
func u32 Parser.parseArrayValues(Parser* p) {
fn u32 Parser.parseArrayValues(Parser* p) {
//printf("parseArrayValues()\n");
p.consumeToken();
u32 value = p.parseValue() | ValueIsArray;
@@ -280,7 +280,7 @@ func u32 Parser.parseArrayValues(Parser* p) {
return value;
}
func u32 Parser.addTable(Parser* p, const char* name, u32 depth, bool isTop, NodeKind kind) {
fn u32 Parser.addTable(Parser* p, const char* name, u32 depth, bool isTop, NodeKind kind) {
//printf("addTable %s\n", name);
Blocks* blocks = p.blocks;
if (!isTop && p.numParents > depth && same(blocks.getName(p.parents[depth]), name)) {
@@ -342,18 +342,18 @@ func u32 Parser.addTable(Parser* p, const char* name, u32 depth, bool isTop, Nod
return 0;
}
func Location! Parser.consumeToken(Parser* p)
fn Location! Parser.consumeToken(Parser* p)
{
Location prev = p.tok.loc;
try p.tokenizer.lex(&p.tok);
return prev;
}
func Token* Parser.nextToken(Parser* p) {
fn Token* Parser.nextToken(Parser* p) {
return p.tokenizer.lookahead();
}
func void! Parser.expectAndConsume(Parser* p, TokenKind k) {
fn void! Parser.expectAndConsume(Parser* p, TokenKind k) {
if (p.tok.isNot(k))
{
sprintf(p.errorMsg, "expected '%s' at %s", token2str(k), p.tok.loc.str());
@@ -362,7 +362,7 @@ func void! Parser.expectAndConsume(Parser* p, TokenKind k) {
try p.consumeToken();
}
func void Parser.expect(Parser* p, TokenKind k)
fn void Parser.expect(Parser* p, TokenKind k)
{
if (p.tok.isNot(k))
{
@@ -379,7 +379,7 @@ public struct TomlReader @opaque
Blocks* blocks;
}
public func TomlReader* new_toml()
public fn TomlReader* new_toml()
{
TomlReader* r = @malloc(TomlReader);
r.blocks = @malloc(Blocks);
@@ -387,21 +387,21 @@ public func TomlReader* new_toml()
return r;
}
public func void TomlReader.destroy(TomlReader* r)
public fn void TomlReader.destroy(TomlReader* r)
{
r.blocks.destroy();
free(r.blocks);
free(r);
}
public func const char* TomlReader.getMsg(const TomlReader* r)
public fn const char* TomlReader.getMsg(const TomlReader* r)
{
return r.message;
}
error EmptyFileError;
public func void! TomlReader.parse(TomlReader* r, string filename)
public fn void! TomlReader.parse(TomlReader* r, string filename)
{
Reader file;
@@ -427,7 +427,7 @@ $endif
// --------------------------------------------------------------
// Getters+iters
func const Node* Reader.findNode(const Reader* r, const char* key)
fn const Node* Reader.findNode(const Reader* r, const char* key)
{
char[MaxText] name;
const char* cp = key;
@@ -459,7 +459,7 @@ func const Node* Reader.findNode(const Reader* r, const char* key)
return nil;
}
public func const char* Reader.getValue(const Reader* r, const char* key) {
public fn const char* Reader.getValue(const Reader* r, const char* key) {
const Node* node = r.findNode(key);
if (!node) return nil;
if (getKind(node.nameOffset) != NodeKind.Value) return nil;
@@ -468,7 +468,7 @@ public func const char* Reader.getValue(const Reader* r, const char* key) {
return &r.blocks.values[getRawValue(node.rawValue)];
}
public func bool Reader.getNumber(const Reader* r, const char* key, u32* result) {
public fn bool Reader.getNumber(const Reader* r, const char* key, u32* result) {
const Node* node = r.findNode(key);
if (!node) return false;
if (getKind(node.nameOffset) != NodeKind.Value) return false;
@@ -478,7 +478,7 @@ public func bool Reader.getNumber(const Reader* r, const char* key, u32* result)
return true;
}
public func bool Reader.getBool(const Reader* r, const char* key, bool* result) {
public fn bool Reader.getBool(const Reader* r, const char* key, bool* result) {
const Node* node = r.findNode(key);
if (!node) return false;
if (getKind(node.nameOffset) != NodeKind.Value) return false;
@@ -493,18 +493,18 @@ public type NodeIter struct {
const Node* node;
}
public func bool NodeIter.done(const NodeIter* i) {
public fn bool NodeIter.done(const NodeIter* i) {
return i.node == nil;
}
public func void NodeIter.next(NodeIter* i) {
public fn void NodeIter.next(NodeIter* i) {
if (i.node == nil) return;
u32 next = i.node.nextNode;
if (next == 0) i.node = nil;
else i.node = &i.blocks.nodes[next];
}
public func const char* NodeIter.getValue(const NodeIter* i, const char* key) {
public fn const char* NodeIter.getValue(const NodeIter* i, const char* key) {
const Node* child = i.blocks.findNode(key, i.node);
if (!child) return nil;
if (getKind(child.nameOffset) != NodeKind.Value) return nil;
@@ -513,7 +513,7 @@ public func const char* NodeIter.getValue(const NodeIter* i, const char* key) {
return &i.blocks.values[getRawValue(child.rawValue)];
}
public func bool NodeIter.getNumber(const NodeIter* i, const char* key, u32* result) {
public fn bool NodeIter.getNumber(const NodeIter* i, const char* key, u32* result) {
const Node* child = i.blocks.findNode(key, i.node);
if (!child) return false;
if (getKind(child.nameOffset) != NodeKind.Value) return false;
@@ -523,7 +523,7 @@ public func bool NodeIter.getNumber(const NodeIter* i, const char* key, u32* res
return true;
}
public func bool NodeIter.getBool(const NodeIter* i, const char* key, bool* result) {
public fn bool NodeIter.getBool(const NodeIter* i, const char* key, bool* result) {
const Node* child = i.blocks.findNode(key, i.node);
if (!child) return false;
if (getKind(child.nameOffset) != NodeKind.Value) return false;
@@ -533,7 +533,7 @@ public func bool NodeIter.getBool(const NodeIter* i, const char* key, bool* resu
return true;
}
public func NodeIter Reader.getNodeIter(const Reader* r, const char* key) {
public fn NodeIter Reader.getNodeIter(const Reader* r, const char* key) {
const Node* node = r.findNode(key);
if (node && getKind(node.nameOffset) == NodeKind.TableArray) {
node = &r.blocks.nodes[node.child];
@@ -548,26 +548,26 @@ public type ValueIter struct {
bool isArray;
}
func ValueIter ValueIter.create(const char* values, bool isArray) {
fn ValueIter ValueIter.create(const char* values, bool isArray) {
ValueIter iter = { values, isArray }
return iter;
}
public func bool ValueIter.done(const ValueIter* i) {
public fn bool ValueIter.done(const ValueIter* i) {
return i.values[0] == 0;
}
public func void ValueIter.next(ValueIter* i) {
public fn void ValueIter.next(ValueIter* i) {
if (i.values[0] == 0) return;
while (i.values[0] != 0) i.values++;
if (i.isArray) i.values++; // skip 0-terminator
}
public func const char* ValueIter.getValue(const ValueIter* i) {
public fn const char* ValueIter.getValue(const ValueIter* i) {
return i.values;
}
public func ValueIter Reader.getValueIter(const Reader* r, const char* key) {
public fn ValueIter Reader.getValueIter(const Reader* r, const char* key) {
const Node* node = r.findNode(key);
if (node) {
switch (getKind(node.nameOffset)) {
@@ -608,7 +608,7 @@ const u32 ValueIsArray = (1 << 31);
const u32 ValueTypeOffset = 29;
const u32 RawValueMask = (0x7 << 29);
func const char* type2str(ValueType t) {
fn const char* type2str(ValueType t) {
switch (t) {
case ValueType.Text: return "T";
case ValueType.Number: return "N";
@@ -643,7 +643,7 @@ public type Blocks struct {
u32 valuesSize;
} @(opaque)
func void Blocks.init(Blocks* b) {
fn void Blocks.init(Blocks* b) {
memset(b, 0, sizeof(Blocks));
b.nodes = calloc(MaxNodes, sizeof(Node));
@@ -662,13 +662,13 @@ func void Blocks.init(Blocks* b) {
memset(b.namesCache, 0, sizeof(u32)*NamesCacheSize);
}
func void Blocks.destroy(Blocks* b) {
fn void Blocks.destroy(Blocks* b) {
free(b.values);
free(b.names);
free(b.nodes);
}
func u32 Blocks.searchNameCache(Blocks* b, const char* name) {
fn u32 Blocks.searchNameCache(Blocks* b, const char* name) {
for (u32 i=0; i<NamesCacheSize; ++i) {
u32 off = b.namesCache[i];
if (off && same(&b.names[off], name)) return off;
@@ -676,12 +676,12 @@ func u32 Blocks.searchNameCache(Blocks* b, const char* name) {
return 0;
}
func const char* Blocks.getName(const Blocks* b, const Node* node) {
fn const char* Blocks.getName(const Blocks* b, const Node* node) {
return &b.names[getValue(node.nameOffset)];
}
func u32 Blocks.addNode(Blocks* b, const char* name, NodeKind k) {
fn u32 Blocks.addNode(Blocks* b, const char* name, NodeKind k) {
if (b.nodeCount == MaxNodes) {
// TODO jmp?
printf("node limit reached\n");
@@ -712,7 +712,7 @@ func u32 Blocks.addNode(Blocks* b, const char* name, NodeKind k) {
return off;
}
func u32 Blocks.addValue(Blocks* b, const char* value) {
fn u32 Blocks.addValue(Blocks* b, const char* value) {
if (value[0] == 0) return 0;
u32 off = b.valuesOffset;
u32 len = cast<u32>(strlen(value)) + 1;
@@ -721,12 +721,12 @@ func u32 Blocks.addValue(Blocks* b, const char* value) {
return off;
}
func void Blocks.addNull(Blocks* b) {
fn void Blocks.addNull(Blocks* b) {
b.values[b.valuesOffset] = 0;
b.valuesOffset++;
}
func Node* Blocks.findNode(const Blocks* b, const char* name, const Node* parent) {
fn Node* Blocks.findNode(const Blocks* b, const char* name, const Node* parent) {
if (b.nodeCount == 0) return nil;
Node* node = &b.nodes[0];
if (parent) {
@@ -746,14 +746,14 @@ func Node* Blocks.findNode(const Blocks* b, const char* name, const Node* parent
const u32 NodeKindOffset = 29;
func u32 addKind(u32 value, NodeKind k) @(inline) {
fn u32 addKind(u32 value, NodeKind k) @(inline) {
return value | (k << NodeKindOffset);
}
func NodeKind getKind(u32 value) @(inline) {
fn NodeKind getKind(u32 value) @(inline) {
return cast<NodeKind>(value >> NodeKindOffset);
}
func u32 getValue(u32 value) @(inline) {
fn u32 getValue(u32 value) @(inline) {
return value & ~(0x7 << NodeKindOffset);
}

36
resources/examples/notworking/toml_tokenizer_c2.c3
View File

@@ -25,13 +25,13 @@ enum TokenKind : char (String name)
ERROR("error"),
}
func void Location.init(Location* l, uint line = 0, uint col = 0)
fn void Location.init(Location* l, uint line = 0, uint col = 0)
{
l.line = line;
l.column = col;
}
func string Location.str(Location* l)
fn string Location.str(Location* l)
{
static char[32] msg;
sprintf(msg, "line %u:%u", l.line, l.column);
@@ -50,7 +50,7 @@ struct Token
}
}
func void Token.init(Token* t)
fn void Token.init(Token* t)
{
t.loc.init(0, 0);
t.kind = TokenKind.EOF;
@@ -58,28 +58,28 @@ func void Token.init(Token* t)
t.number = 0;
}
func void Token.clear(Token* t)
fn void Token.clear(Token* t)
{
t.text = nil;
t.number = 0;
}
func void Token.setLocation(Token* t, Location l)
fn void Token.setLocation(Token* t, Location l)
{
t.loc = l;
}
func bool Token.is(Token* t, TokenKind k)
fn bool Token.is(Token* t, TokenKind k)
{
return t.kind == k;
}
func bool Token.isNot(Token* t, TokenKind k)
fn bool Token.isNot(Token* t, TokenKind k)
{
return t.kind != k;
}
func string Token.getName(Token* t)
fn string Token.getName(Token* t)
{
return t.kind.name;
}
@@ -94,7 +94,7 @@ struct Tokenizer
bool haveNext;
}
func void Tokenizer.init(Tokenizer* t, char* input)
fn void Tokenizer.init(Tokenizer* t, char* input)
{
t.dataStart = input;
t.current = input;
@@ -109,7 +109,7 @@ error LexError
string error_message;
}
func void! Tokenizer.lex(Tokenizer* t, Token* result)
fn void! Tokenizer.lex(Tokenizer* t, Token* result)
{
if (t.haveNext)
{
@@ -221,7 +221,7 @@ func void! Tokenizer.lex(Tokenizer* t, Token* result)
}
}
func Token*! Tokenizer.lookahead(Tokenizer* t)
fn Token*! Tokenizer.lookahead(Tokenizer* t)
{
if (!t.haveNext)
{
@@ -231,13 +231,13 @@ func Token*! Tokenizer.lookahead(Tokenizer* t)
return &t.nextToken;
}
func void Tokenizer.advance(Tokenizer* t, uint amount)
fn void Tokenizer.advance(Tokenizer* t, uint amount)
{
t.loc.column += amount;
t.current += amount;
}
func void Tokenizer.parseComment(Tokenizer* t)
fn void Tokenizer.parseComment(Tokenizer* t)
{
while (1)
{
@@ -258,7 +258,7 @@ func void Tokenizer.parseComment(Tokenizer* t)
}
}
func void Tokenizer.parseText(Tokenizer* t, Token* result)
fn void Tokenizer.parseText(Tokenizer* t, Token* result)
{
// TODO handle literal strings ' .. ' -> no escaping
// TODO handle escape chars for normal strings " .. \" \r \n "
@@ -277,7 +277,7 @@ func void Tokenizer.parseText(Tokenizer* t, Token* result)
t.advance(1);
}
func void! Tokenizer.parseMultiText(Tokenizer* t, Token* result)
fn void! Tokenizer.parseMultiText(Tokenizer* t, Token* result)
{
t.advance(3);
if (t.current[0] == '\n')
@@ -317,7 +317,7 @@ func void! Tokenizer.parseMultiText(Tokenizer* t, Token* result)
t.advance(3);
}
func void Tokenizer.parseNumber(Tokenizer* t, Token* result)
fn void Tokenizer.parseNumber(Tokenizer* t, Token* result)
{
// TODO handle prefix +/-
// handle hexadecimal/ocal/binary number
@@ -333,7 +333,7 @@ func void Tokenizer.parseNumber(Tokenizer* t, Token* result)
}
}
func bool isKeyChar(u8 c)
fn bool isKeyChar(u8 c)
{
if (c >= 128) return true;
if (isalpha(c)) return true;
@@ -342,7 +342,7 @@ func bool isKeyChar(u8 c)
return false;
}
func void Tokenizer.parseKey(Tokenizer* t, Token* result)
fn void Tokenizer.parseKey(Tokenizer* t, Token* result)
{
char* start = t.current;
while (t.current[0] && isKeyChar((char)(t.current[0]))) t.current++;

16
resources/examples/notworking/vector.c3
View File

@@ -5,42 +5,42 @@ public struct Vector
Type[] array;
}
public func void Vector.init()
public fn void Vector.init()
{
array = nil;
}
public func void Vector.add(Vector *vector, Type type)
public fn void Vector.add(Vector *vector, Type type)
{
vector.array += type;
}
public func usize Vector.size(Vector *vector)
public fn usize Vector.size(Vector *vector)
{
return vector.array.size;
}
public func void Vector.removeLast(Vector *vector)
public fn void Vector.removeLast(Vector *vector)
{
vector.array.pop();
}
public func void Vector.removefirst(Vector *vector)
public fn void Vector.removefirst(Vector *vector)
{
vector.array.removeAt(0);
}
public func void Type *Vector.first(Vector *vector)
public fn void Type *Vector.first(Vector *vector)
{
return &vector.array.first;
}
public func void Type *Vector.last(Vector *vector)
public fn void Type *Vector.last(Vector *vector)
{
return &vector.array.last();
}
public func bool Vector.empty(Vector *vector)
public fn bool Vector.empty(Vector *vector)
{
return !vector.array.size;
}

16
resources/examples/notworking/virtuals.c3
View File

@@ -3,8 +3,8 @@ import std::math;
interface Geometry
{
func double area();
func double perim();
fn double area();
fn double perim();
}
struct Rect
@@ -17,32 +17,32 @@ struct Circle
double radius;
}
func double Rect.area(Rect *r)
fn double Rect.area(Rect *r)
{
return r.width * r.height;
}
func double Rect.perim(Rect *r)
fn double Rect.perim(Rect *r)
{
return 2 * r.width + 2 * r.height;
}
func double Circle.area(Circle *c)
fn double Circle.area(Circle *c)
{
return math::PI * c.radius * c.radius
}
func double Circle.perim(Circle *c)
fn double Circle.perim(Circle *c)
{
return math::PI * c.radius * 2;
}
func void measure(virtual Geometry g)
fn void measure(virtual Geometry g)
{
printf("area: %f, perimeter: %f\n", g.area(), g.perim());
}
func void main()
fn void main()
{
Rect r = { 3, 4 };
Circle c = { 5 };

2
resources/examples/notworking/window.c3
View File

@@ -3,7 +3,7 @@ import gtk;
const string CLICK_ME = "Click Me";
uint counter = 0;
func void clickedme(GtkButton *o, void *d)
fn void clickedme(GtkButton *o, void *d)
{
(GtkLabel*)(d).set_text(string.format("You clicked me %d times", ++counter));
}

16
resources/examples/spectralnorm.c3
View File

@@ -2,18 +2,18 @@ module spectralnorm;
import std::mem;
import std::array;
extern func int atoi(char *s);
extern func int printf(char *s, ...);
extern func double sqrt(double);
extern fn int atoi(char *s);
extern fn int printf(char *s, ...);
extern fn double sqrt(double);
double[] temparr;
func double eval_A(int i, int j)
fn double eval_A(int i, int j)
{
return 1.0 / ((i + j) * (i + j + 1) / 2 + i + 1);
}
func void eval_A_times_u(double[] u, double[] au)
fn void eval_A_times_u(double[] u, double[] au)
{
foreach (i, &val : au)
{
@@ -25,7 +25,7 @@ func void eval_A_times_u(double[] u, double[] au)
}
}
func void eval_At_times_u(double[] u, double[] au)
fn void eval_At_times_u(double[] u, double[] au)
{
foreach (i, &val : au)
{
@@ -37,13 +37,13 @@ func void eval_At_times_u(double[] u, double[] au)
}
}
func void eval_AtA_times_u(double[] u, double[] atau) @noinline
fn void eval_AtA_times_u(double[] u, double[] atau) @noinline
{
eval_A_times_u(u, temparr);
eval_At_times_u(temparr, atau);
}
func int main(int argc, char **argv)
fn int main(int argc, char **argv)
{
int n = (argc == 2) ? atoi(argv[1]) : 2000;
temparr = @array::make(double, n);

2
resources/grammar/c3.l
View File

@@ -56,7 +56,7 @@ void comment(void);
"void" { count(); return(VOID); }
"volatile" { count(); return(VOLATILE); }
"while" { count(); return(WHILE); }
"func" { count(); return(FUNC); }
"fn" { count(); return(FUNC); }
"nil" { count(); return(NIL); }
"next" { count(); return(NEXT); }
"in" { count(); return(IN); }

10
resources/lib/std/hash/adler32.c3
View File

@@ -8,18 +8,18 @@ struct Adler32
uint b;
}
func void Adler32.init(Adler32 *this)
fn void Adler32.init(Adler32 *this)
{
*this = { 1, 0 };
}
func void Adler32.updatec(Adler32* this, char c)
fn void Adler32.updatec(Adler32* this, char c)
{
this.a = (this.a + c) % ADLER_CONST;
this.b = (this.b + this.a) % ADLER_CONST;
}
func void Adler32.update(Adler32* this, char[] data)
fn void Adler32.update(Adler32* this, char[] data)
{
uint a = this.a;
uint b = this.b;
@@ -31,12 +31,12 @@ func void Adler32.update(Adler32* this, char[] data)
*this = { a, b };
}
func uint Adler32.final(Adler32* this)
fn uint Adler32.final(Adler32* this)
{
return (this.b << 16) | this.a;
}
func uint encode(char[] data)
fn uint encode(char[] data)
{
uint a = 1;
uint b = 0;

10
resources/lib/std/hash/crc32.c3
View File

@@ -5,17 +5,17 @@ struct Crc32
uint result;
}
func void Crc32.init(Crc32* this, uint seed = 0)
fn void Crc32.init(Crc32* this, uint seed = 0)
{
this.result = ~seed;
}
func void Crc32.updatec(Crc32* this, char c)
fn void Crc32.updatec(Crc32* this, char c)
{
this.result = (this.result >> 8) ^ CRC32_TABLE[(this.result ^ c) & 0xFF];
}
func void Crc32.update(Crc32* this, char[] data)
fn void Crc32.update(Crc32* this, char[] data)
{
uint result = this.result;
foreach (char x : data)
@@ -25,12 +25,12 @@ func void Crc32.update(Crc32* this, char[] data)
this.result = result;
}
func uint Crc32.final(Crc32* this)
fn uint Crc32.final(Crc32* this)
{
return ~this.result;
}
func uint encode(char[] data)
fn uint encode(char[] data)
{
uint result = ~(uint)(0);
foreach (char x : data)

10
resources/lib/std/hash/crc64.c3
View File

@@ -5,17 +5,17 @@ struct Crc64
ulong result;
}
func void Crc64.init(Crc64* this, uint seed = 0)
fn void Crc64.init(Crc64* this, uint seed = 0)
{
this.result = seed;
}
func void Crc64.updatec(Crc64* this, char c)
fn void Crc64.updatec(Crc64* this, char c)
{
this.result = (this.result << 8) ^ CRC64_TABLE[(char)((this.result >> 56) ^ c)];
}
func void Crc64.update(Crc64* this, char[] data)
fn void Crc64.update(Crc64* this, char[] data)
{
ulong result = this.result;
foreach (char x : data)
@@ -25,12 +25,12 @@ func void Crc64.update(Crc64* this, char[] data)
this.result = result;
}
func ulong Crc64.final(Crc64* this)
fn ulong Crc64.final(Crc64* this)
{
return this.result;
}
func ulong encode(char[] data)
fn ulong encode(char[] data)
{
ulong result = (ulong)(0);
foreach (char x : data)

14
resources/lib/std/io.c3
View File

@@ -29,18 +29,18 @@ struct File
void *file;
}
extern func int _puts(char* message) @extname("puts");
extern func int printf(char* message, ...);
extern func int _putchar(char c) @extname("putchar");
extern fn int _puts(char* message) @extname("puts");
extern fn int printf(char* message, ...);
extern fn int _putchar(char c) @extname("putchar");
extern File *__stdinp;
func int putchar(char c) @inline
fn int putchar(char c) @inline
{
return _putchar(c);
}
func int print(char *message)
fn int print(char *message)
{
char* pointer = message;
while (*pointer != '\0')
@@ -51,13 +51,13 @@ func int print(char *message)
return 1;
}
func int println(char *message = "") @inline
fn int println(char *message = "") @inline
{
return _puts(message);
}
func void! File.open(File* file, char[] filename, char[] mode)
fn void! File.open(File* file, char[] filename, char[] mode)
{
char* filename_copy = mem::talloc(filename.len + 1)!!;

20
resources/lib/std/linkedlist.c3
View File

@@ -15,12 +15,12 @@ struct LinkedList
Node *last;
}
func void LinkedList.push(LinkedList *list, Type value)
fn void LinkedList.push(LinkedList *list, Type value)
{
list.linkLast(value);
}
private func void LinkedList.linkFirst(LinkedList *list, Type value)
private fn void LinkedList.linkFirst(LinkedList *list, Type value)
{
Node *first = list.first;
Node *new_node = @mem::malloc(Node);
@@ -37,7 +37,7 @@ private func void LinkedList.linkFirst(LinkedList *list, Type value)
list.size++;
}
private func void LinkedList.linkLast(LinkedList *list, Type value)
private fn void LinkedList.linkLast(LinkedList *list, Type value)
{
Node *last = list.last;
Node *new_node = mem::alloc($sizeof(Node));
@@ -54,7 +54,7 @@ private func void LinkedList.linkLast(LinkedList *list, Type value)
list.size++;
}
func void LinkedList.free(LinkedList *list)
fn void LinkedList.free(LinkedList *list)
{
for (Node* node = list.first; node != null;)
{
@@ -67,12 +67,12 @@ func void LinkedList.free(LinkedList *list)
list.size = 0;
}
func usize LinkedList.len(LinkedList* list) @inline
fn usize LinkedList.len(LinkedList* list) @inline
{
return list.size;
}
func Type LinkedList.get(LinkedList* list, usize index)
fn Type LinkedList.get(LinkedList* list, usize index)
{
Node* node = list.first;
while (index--)
@@ -84,7 +84,7 @@ func Type LinkedList.get(LinkedList* list, usize index)
/**
* @require succ != null
**/
private func void LinkedList.linkBefore(LinkedList *list, Node *succ, Type value)
private fn void LinkedList.linkBefore(LinkedList *list, Node *succ, Type value)
{
Node* pred = succ.prev;
Node* new_node = @mem::malloc(Node);
@@ -104,7 +104,7 @@ private func void LinkedList.linkBefore(LinkedList *list, Node *succ, Type value
/**
* @require f == list.first && f != null
**/
private func void unlinkFirst(LinkedList* list, Node* f)
private fn void unlinkFirst(LinkedList* list, Node* f)
{
Node* next = f.next;
mem::free(f);
@@ -123,7 +123,7 @@ private func void unlinkFirst(LinkedList* list, Node* f)
/**
* @require l == list.last && l != null
**/
private func void LinkedList.unlinkLast(LinkedList *list, Node* l)
private fn void LinkedList.unlinkLast(LinkedList *list, Node* l)
{
Node* prev = l.prev;
list.last = prev;
@@ -142,7 +142,7 @@ private func void LinkedList.unlinkLast(LinkedList *list, Node* l)
/**
* @require x != null
**/
private func void LinkedList.unlink(LinkedList* list, Node* x)
private fn void LinkedList.unlink(LinkedList* list, Node* x)
{
Node* next = x.next;
Node* prev = x.prev;

32
resources/lib/std/list.c3
View File

@@ -8,7 +8,7 @@ struct List
Type *entries;
}
private func void List.ensureCapacity(List *list) @inline
private fn void List.ensureCapacity(List *list) @inline
{
if (list.capacity == list.size)
{
@@ -17,12 +17,12 @@ private func void List.ensureCapacity(List *list) @inline
}
}
func void List.push(List *list, Type element) @inline
fn void List.push(List *list, Type element) @inline
{
list.append(element);
}
func void List.append(List *list, Type element)
fn void List.append(List *list, Type element)
{
list.ensureCapacity();
list.entries[list.size++] = element;
@@ -31,7 +31,7 @@ func void List.append(List *list, Type element)
/**
* @require list.size > 0
*/
func Type List.pop(List *list)
fn Type List.pop(List *list)
{
return list.entries[--list.size];
}
@@ -39,14 +39,14 @@ func Type List.pop(List *list)
/**
* @require list.size > 0
*/
func Type List.popFirst(List *list)
fn Type List.popFirst(List *list)
{
Type value = list.entries[0];
list.removeAt(0);
return value;
}
func void List.removeAt(List *list, usize index)
fn void List.removeAt(List *list, usize index)
{
for (usize i = index + 1; i < list.size; i++)
{
@@ -55,12 +55,12 @@ func void List.removeAt(List *list, usize index)
list.size--;
}
func void List.pushFront(List *list, Type type) @inline
fn void List.pushFront(List *list, Type type) @inline
{
list.insertAt(0, type);
}
func void List.insertAt(List *list, usize index, Type type)
fn void List.insertAt(List *list, usize index, Type type)
{
list.ensureCapacity();
for (usize i = list.size; i > index; i--)
@@ -71,42 +71,42 @@ func void List.insertAt(List *list, usize index, Type type)
list.entries[index] = type;
}
func void List.removeLast(List *list)
fn void List.removeLast(List *list)
{
list.size--;
}
func void List.removeFirst(List *list)
fn void List.removeFirst(List *list)
{
list.removeAt(0);
}
func Type* List.first(List *list)
fn Type* List.first(List *list)
{
return list.size ? &list.entries[0] : null;
}
func Type* List.last(List *list)
fn Type* List.last(List *list)
{
return list.size ? &list.entries[list.size - 1] : null;
}
func bool List.isEmpty(List *list)
fn bool List.isEmpty(List *list)
{
return list.size;
}
func usize List.len(List *list)
fn usize List.len(List *list)
{
return list.size;
}
func Type List.get(List *list, usize index)
fn Type List.get(List *list, usize index)
{
return list.entries[index];
}
func void List.free(List *list)
fn void List.free(List *list)
{
mem::free(list.entries);
list.capacity = 0;

30
resources/lib/std/mem.c3
View File

@@ -1,9 +1,9 @@
module std::mem;
extern func void* _malloc(usize bytes) @extname("malloc");
extern func void* _realloc(void* ptr, usize bytes) @extname("realloc");
extern func void* _calloc(usize bytes, usize elements) @extname("calloc");
extern func void _free(void* ptr) @extname("free");
extern fn void* _malloc(usize bytes) @extname("malloc");
extern fn void* _realloc(void* ptr, usize bytes) @extname("realloc");
extern fn void* _calloc(usize bytes, usize elements) @extname("calloc");
extern fn void _free(void* ptr) @extname("free");
macro volatile_load(&x)
{
@@ -27,7 +27,7 @@ errtype AllocationFailure
OUT_OF_MEMORY
}
define AllocatorFunction = func void!(void *data, void** pointer, usize bytes, usize alignment, AllocationKind kind);
define AllocatorFunction = fn void!(void *data, void** pointer, usize bytes, usize alignment, AllocationKind kind);
struct Allocator
{
@@ -35,12 +35,12 @@ struct Allocator
void *data;
}
func void copy(char* dst, char* src, usize size)
fn void copy(char* dst, char* src, usize size)
{
for (usize i = 0; i < size; i++) dst[i] = src[i];
}
func void! system_malloc_function(void *unused, void** pointer, usize bytes, usize alignment, AllocationKind kind) @inline
fn void! system_malloc_function(void *unused, void** pointer, usize bytes, usize alignment, AllocationKind kind) @inline
{
switch (kind)
{
@@ -72,7 +72,7 @@ struct SlotAllocator
usize current_page;
}
func void*! SlotAllocator.alloc(SlotAllocator *allocator, usize size)
fn void*! SlotAllocator.alloc(SlotAllocator *allocator, usize size)
{
void* active_page = (char*)(allocator.pages) + allocator.current_page * allocator.page_size;
void** page_pointer = (void**)(active_page);
@@ -101,7 +101,7 @@ struct RingAllocator
}
func void* RingAllocator.alloc(RingAllocator *allocator, usize size)
fn void* RingAllocator.alloc(RingAllocator *allocator, usize size)
{
if (size > allocator.size) return null;
// Wraparound? If so, start at the beginning.
@@ -115,7 +115,7 @@ func void* RingAllocator.alloc(RingAllocator *allocator, usize size)
return data;
}
func void* RingAllocator.realloc(RingAllocator *allocator, void* ptr, usize size)
fn void* RingAllocator.realloc(RingAllocator *allocator, void* ptr, usize size)
{
if (size > allocator.size) return null;
assert(allocator.data >= ptr && ptr < allocator.data + size, "Realloc on other allocator.");
@@ -159,22 +159,22 @@ macro malloc($Type)
return ($Type*)(mem::alloc($sizeof($Type)));
}
func void* alloc(usize size, usize count = 1) @inline
fn void* alloc(usize size, usize count = 1) @inline
{
return _malloc(size * count);
}
func void* calloc(usize size, usize elements = 1) @inline
fn void* calloc(usize size, usize elements = 1) @inline
{
return _calloc(size, elements);
}
func void* realloc(void *ptr, usize size) @inline
fn void* realloc(void *ptr, usize size) @inline
{
return _realloc(ptr, size);
}
func void free(void* ptr) @inline
fn void free(void* ptr) @inline
{
_free(ptr);
}
@@ -194,7 +194,7 @@ SlotAllocator default_allocator = {
.current_page = 0,
};
func void*! talloc(usize size)
fn void*! talloc(usize size)
{
return default_allocator.alloc(size);
}

6
resources/rosettacode/antiprime.c3
View File

@@ -1,9 +1,9 @@
module antiprime;
import std::io;
extern func int printf(char* message, ...);
extern fn int printf(char* message, ...);
func int countDivisors(int n)
fn int countDivisors(int n)
{
if (n < 2) return 1;
int count = 2;
@@ -14,7 +14,7 @@ func int countDivisors(int n)
return count;
}
func int main()
fn int main()
{
int maxDiv;
int count;

2
resources/rosettacode/helloworld.c3
View File

@@ -1,6 +1,6 @@
import std::io;
func int main()
fn int main()
{
io::println("Hello world");
return 0;

26
resources/testfragments/bigint.c3
View File

@@ -13,7 +13,7 @@ public struct BigInt @opaque
char sign;
}
public func void BigInt.init(BigInt* bigInt)
public fn void BigInt.init(BigInt* bigInt)
{
bigInt.number = malloc(1);
bigInt.number[0] = 0;
@@ -21,7 +21,7 @@ public func void BigInt.init(BigInt* bigInt)
bigInt.sign = 1;
}
public func void BigInt.initFromString(BigInt* bigInt, char* str)
public fn void BigInt.initFromString(BigInt* bigInt, char* str)
{
uint size = strlen(str);
bigInt.sign = 1;
@@ -46,7 +46,7 @@ public func void BigInt.initFromString(BigInt* bigInt, char* str)
bigInt.length = size;
}
public func void BigInt.copyTo(BigInt* source, BigInt* target)
public fn void BigInt.copyTo(BigInt* source, BigInt* target)
{
target.number = realloc(target.number, source.length);
target.sign = source.sign;
@@ -54,12 +54,12 @@ public func void BigInt.copyTo(BigInt* source, BigInt* target)
for (uint i = 0; i < target.length; i++) target.number[i] = source.number[i];
}
public func void BigInt.destroy(BigInt* bigInt)
public fn void BigInt.destroy(BigInt* bigInt)
{
free(bigInt.number);
}
func void BigInt.addIgnoreSign(BigInt* a, BigInt* b, BigInt* result)
fn void BigInt.addIgnoreSign(BigInt* a, BigInt* b, BigInt* result)
{
uint length = @max(a.length, b.length) + 1;
byte* res = malloc(length);
@@ -98,7 +98,7 @@ func void BigInt.addIgnoreSign(BigInt* a, BigInt* b, BigInt* result)
result.length = length;
}
public func void BigInt.getMaxVal(BigInt* bigInt, uint* pos, int* val)
public fn void BigInt.getMaxVal(BigInt* bigInt, uint* pos, int* val)
{
for (uint i = bigInt.length; i > 0; i++)
{
@@ -113,7 +113,7 @@ public func void BigInt.getMaxVal(BigInt* bigInt, uint* pos, int* val)
*val = 0;
}
public func char BigInt.compare(BigInt* a, BigInt* b)
public fn char BigInt.compare(BigInt* a, BigInt* b)
{
if (a.sign != b.sign) return a.sign;
byte aMax;
@@ -130,7 +130,7 @@ public func char BigInt.compare(BigInt* a, BigInt* b)
return 0;
}
public func char BigInt.compareNoSign(BigInt* a, BigInt* b)
public fn char BigInt.compareNoSign(BigInt* a, BigInt* b)
{
byte aMax;
uint aMaxPos;
@@ -146,7 +146,7 @@ public func char BigInt.compareNoSign(BigInt* a, BigInt* b)
return 0;
}
func void BigInt.subIgnoreSign(BigInt* a, BigInt* b, BigInt* result)
fn void BigInt.subIgnoreSign(BigInt* a, BigInt* b, BigInt* result)
{
uint length = @max(a.length, b.length);
byte* res = malloc(length);
@@ -187,7 +187,7 @@ func void BigInt.subIgnoreSign(BigInt* a, BigInt* b, BigInt* result)
result.length = length;
}
public func void BigInt.add(BigInt* a, BigInt* b, BigInt* result)
public fn void BigInt.add(BigInt* a, BigInt* b, BigInt* result)
{
if (a.sign == b.sign)
{
@@ -205,7 +205,7 @@ public func void BigInt.add(BigInt* a, BigInt* b, BigInt* result)
}
}
public func char* BigInt.toCharArray(BigInt* bigInt)
public fn char* BigInt.toCharArray(BigInt* bigInt)
{
uint charLen = bigInt.length + 1 + (bigInt.sign < 0 ? 1 : 0);
byte* out = malloc(charLen);
@@ -227,7 +227,7 @@ public func char* BigInt.toCharArray(BigInt* bigInt)
return out;
}
public func void BigInt.print(BigInt* bigInt)
public fn void BigInt.print(BigInt* bigInt)
{
char* chars = bigInt.toCharArray();
puts(chars);
@@ -244,7 +244,7 @@ public func void BigInt.fprint(BigInt* bigInt, FILE* file)
}*/
public func int main(int size, char** args)
public fn int main(int size, char** args)
{
BigInt minus2;
BigInt minus1;

6
resources/testfragments/casting.c3
View File

@@ -6,7 +6,7 @@ struct Pixmap
int bpp;
}
func void readpgm(char* name, Pixmap* p)
fn void readpgm(char* name, Pixmap* p)
{
/* ... */
pnm_readpaminit(fp, &inpam);
@@ -28,7 +28,7 @@ func void readpgm(char* name, Pixmap* p)
}
}
func void getComm(uint len, char* src)
fn void getComm(uint len, char* src)
{
uint size;
size = len - 2;
@@ -36,7 +36,7 @@ func void getComm(uint len, char* src)
memcpy(comm, src, size);
}
func uint* decode_fh(uint* p, SvcFh* fhp)
fn uint* decode_fh(uint* p, SvcFh* fhp)
{
int size;
fh_init(fhp, NFS3_FHSIZE);

12
resources/testfragments/comparisons.c3
View File

@@ -1,6 +1,6 @@
module comparisons;
func void test_signed()
fn void test_signed()
{
int a = 0;
int b = 1;
@@ -14,7 +14,7 @@ func void test_signed()
}
func void test_unsigned()
fn void test_unsigned()
{
uint a = 0;
uint b = 1;
@@ -28,9 +28,9 @@ func void test_unsigned()
}
extern func void printf(char *s);
extern fn void printf(char *s);
func void test_signedunsigned()
fn void test_signedunsigned()
{
char a = 0 - 1;
byte b = (byte)(a);
@@ -100,7 +100,7 @@ func void test_signedunsigned()
}
func void test_unsignedsigned()
fn void test_unsignedsigned()
{
int b = -1;
uint a = (uint)(b);
@@ -170,7 +170,7 @@ func void test_unsignedsigned()
}
func void main()
fn void main()
{
test_signedunsigned();
test_unsignedsigned();

28
resources/testfragments/compilertest2.c3
View File

@@ -13,7 +13,7 @@ public struct BigInt @opaque
char sign;
}
public func void BigInt.init(BigInt& bigInt)
public fn void BigInt.init(BigInt& bigInt)
{
bigInt.number = malloc(1);
bigInt.number[0] = 0;
@@ -21,7 +21,7 @@ public func void BigInt.init(BigInt& bigInt)
bigInt.sign = 1;
}
public func void BigInt.initFromString(BigInt& bigInt, char& str)
public fn void BigInt.initFromString(BigInt& bigInt, char& str)
{
uint size = strlen(str);
bigInt.sign = 1;
@@ -46,14 +46,14 @@ public func void BigInt.initFromString(BigInt& bigInt, char& str)
bigInt.length = size;
}
public func BigInt& BigInt.newFromString(char& str)
public fn BigInt& BigInt.newFromString(char& str)
{
BigInt& bigInt = malloc(sizeof(BigInt));
bigInt.initFromString(str);
return bigInt;
}
public func void BigInt.copyTo(BigInt& source, BigInt& target)
public fn void BigInt.copyTo(BigInt& source, BigInt& target)
{
target.number = realloc(target.number, source.length);
target.sign = source.sign;
@@ -61,12 +61,12 @@ public func void BigInt.copyTo(BigInt& source, BigInt& target)
for (uint i = 0; i < target.length; i++) target.number[i] = source.number[i];
}
public func void BigInt.destroy(BigInt& bigInt)
public fn void BigInt.destroy(BigInt& bigInt)
{
free(bigInt.number);
}
func void BigInt.addIgnoreSign(BigInt& a, BigInt& b, BigInt& result)
fn void BigInt.addIgnoreSign(BigInt& a, BigInt& b, BigInt& result)
{
uint length = @max(a.length, b.length) + 1;
byte* res = malloc(length);
@@ -105,7 +105,7 @@ func void BigInt.addIgnoreSign(BigInt& a, BigInt& b, BigInt& result)
result.length = length;
}
public func void BigInt.getMaxVal(BigInt &bigInt, uint& pos, int& val)
public fn void BigInt.getMaxVal(BigInt &bigInt, uint& pos, int& val)
{
for (uint i = bigInt.length; i > 0; i++)
{
@@ -120,7 +120,7 @@ public func void BigInt.getMaxVal(BigInt &bigInt, uint& pos, int& val)
*val = 0;
}
public func char BigInt.compare(BigInt& a, BigInt& b)
public fn char BigInt.compare(BigInt& a, BigInt& b)
{
if (a.sign != b.sign) return a.sign;
byte aMax;
@@ -137,7 +137,7 @@ public func char BigInt.compare(BigInt& a, BigInt& b)
return 0;
}
public func char BigInt.compareNoSign(BigInt& a, BigInt& b)
public fn char BigInt.compareNoSign(BigInt& a, BigInt& b)
{
byte aMax;
uint aMaxPos;
@@ -153,7 +153,7 @@ public func char BigInt.compareNoSign(BigInt& a, BigInt& b)
return 0;
}
func void BigInt.subIgnoreSign(BigInt& a, BigInt& b, BigInt& result)
fn void BigInt.subIgnoreSign(BigInt& a, BigInt& b, BigInt& result)
{
uint length = @max(a.length, b.length);
byte& res = malloc(length);
@@ -194,7 +194,7 @@ func void BigInt.subIgnoreSign(BigInt& a, BigInt& b, BigInt& result)
result.length = length;
}
public func void BigInt.add(BigInt& a, BigInt& b, BigInt& result)
public fn void BigInt.add(BigInt& a, BigInt& b, BigInt& result)
{
if (a.sign == b.sign)
{
@@ -212,7 +212,7 @@ public func void BigInt.add(BigInt& a, BigInt& b, BigInt& result)
}
}
public func char* BigInt.toCharArray(BigInt* bigInt)
public fn char* BigInt.toCharArray(BigInt* bigInt)
{
uint charLen = bigInt.length + 1 + (bigInt.sign < 0 ? 1 : 0);
byte* out = malloc(charLen);
@@ -234,7 +234,7 @@ public func char* BigInt.toCharArray(BigInt* bigInt)
return out;
}
public func void BigInt.print(BigInt& bigInt)
public fn void BigInt.print(BigInt& bigInt)
{
char* chars = bigInt.toCharArray();
puts(chars);
@@ -251,7 +251,7 @@ public func void BigInt.fprint(BigInt* bigInt, FILE* file)
}*/
public func int main(int size, char*& args)
public fn int main(int size, char*& args)
{
BigInt minus2;
BigInt minus1;

12
resources/testfragments/compiletest.c3
View File

@@ -5,7 +5,7 @@ int bob = 'HELO';
typedef Foo* as Bob;
func void testdefer(int x)
fn void testdefer(int x)
{
defer printf("A");
defer
@@ -67,7 +67,7 @@ struct Simple
int i;
double j;
}
func int boo()
fn int boo()
{
Zed zfe;
Simple s = { 1 };
@@ -148,11 +148,11 @@ func int boo()
return 1;
}
func int helo(int i)
fn int helo(int i)
{
return i + 1;
}
func void while_test()
fn void while_test()
{
int a = 10;
@@ -164,7 +164,7 @@ func void while_test()
}
}
func void test()
fn void test()
{
int a = 10;
while (1)
@@ -183,7 +183,7 @@ func void test()
return;
}
func void main()
fn void main()
{
helo(2);
printf("Helo\n");

20
resources/testfragments/demo1.c3
View File

@@ -1,8 +1,8 @@
module demo1;
// Use C functions directly.
extern func int printf(char *, ...);
extern func void puts(char *);
extern fn int printf(char *, ...);
extern fn void puts(char *);
struct Foo
{
@@ -10,7 +10,7 @@ struct Foo
int b;
}
func Foo createFoo(int a, int b = 10)
fn Foo createFoo(int a, int b = 10)
{
// Compound initializer
return Foo({a, b});
@@ -23,7 +23,7 @@ struct Bar
}
func void testStruct()
fn void testStruct()
{
// Default arguments
Foo foo = createFoo(100);
@@ -47,17 +47,17 @@ func void testStruct()
}
func int Bar.add(Bar* b)
fn int Bar.add(Bar* b)
{
return b.x + b.y;
}
func int Foo.mult(Foo* f)
fn int Foo.mult(Foo* f)
{
return f.a * f.b;
}
func void printArray(int[] array)
fn void printArray(int[] array)
{
printf("[");
foreach (i, a : array)
@@ -69,7 +69,7 @@ func void printArray(int[] array)
}
func void testArrays()
fn void testArrays()
{
int[5] x = { [0] = 100, [1..2] = 4 };
puts("Testing arrays---");
@@ -118,7 +118,7 @@ func void testArrays()
printf("Pointer to array: %p\nPointer to slice: %p\nPointer to first element of slice: %p\n", z, &y, &y[0]);
}
func void testExpressionBlocks()
fn void testExpressionBlocks()
{
int x = {|
int j = 0;
@@ -144,7 +144,7 @@ func void testExpressionBlocks()
}
}
func void main()
fn void main()
{
testStruct();
testArrays();

2
resources/testfragments/file1.c3
View File

@@ -11,7 +11,7 @@ struct Foo
//define bar::blub(Foo, 1) as fooblub;
public func void main()
public fn void main()
{
Foo f = { 3, 4 };
//Foo g = fooblub(&f);

2
resources/testfragments/file2.c3
View File

@@ -1,6 +1,6 @@
module bar(Type, i);
public func Type blub(Type type)
public fn Type blub(Type type)
{
type.x = i;
return type;

4
resources/testfragments/helloworld.c3
View File

@@ -1,8 +1,8 @@
module helloworld;
extern func void printf(char *str, ...);
extern fn void printf(char *str, ...);
func void main()
fn void main()
{
printf("Hello World!\n");
}

2
resources/testfragments/lexertest.c3
View File

@@ -11,7 +11,7 @@ struct Boo
};
}
func void test()
fn void test()
{
int i = 0;
i++;

18
resources/testfragments/parsertest.c3
View File

@@ -68,7 +68,7 @@ error Errors
OTHER_ERROR
}
func Foom test(int a)
fn Foom test(int a)
{
while (int x = 0, int y = 3; int y = foo())
{
@@ -85,7 +85,7 @@ func Foom test(int a)
return 1 + 2;
}
func boo::Bar zab::Baz.sd(die::Eij i) throws Zab // , sij:Zig
fn boo::Bar zab::Baz.sd(die::Eij i) throws Zab // , sij:Zig
{
float a = 0, b = 3, double c = 1, d;
int i = 0;
@@ -111,20 +111,20 @@ generic boor2(i)
$if ($e > 0)
{
func void foo() {}
fn void foo() {}
}
$elif ($e < 0)
{
func void foo() { printf("HELO"); }
fn void foo() { printf("HELO"); }
}
$else
{
func void foo() { printf("OLEH"); }
fn void foo() { printf("OLEH"); }
}
$if ($e > 0)
{
func void foo() {}
fn void foo() {}
}
$if ($b > 0)
@@ -151,7 +151,7 @@ generic boofer2(i, g, eok)
func void hello() throws Errors
fn void hello() throws Errors
{
int i, j;
throw FOO;
@@ -229,11 +229,11 @@ func void hello() throws Errors
}
typedef Foo* as Bar;
typedef func void(int, Foo*) as Zoo;
typedef fn void(int, Foo*) as Zoo;
func void test2()
fn void test2()
{
return;
}

28
resources/testfragments/sdl2.c3
View File

@@ -26,11 +26,11 @@ void* gWindow = null;
void* gScreenSurface = null;
extern func int init(uint flags) @extname("SDL_Init");
extern func int initSubSystem(uint flags) @extname("SDL_InitSubSystem");
extern func void quitSubSystem(uint flags) @extname("SDL_QuitSubSystem");
extern func uint wasInit(uint flags) @extname("SDL_WasInit");
extern func void quit() @extname("SDL_Quit");
extern fn int init(uint flags) @extname("SDL_Init");
extern fn int initSubSystem(uint flags) @extname("SDL_InitSubSystem");
extern fn void quitSubSystem(uint flags) @extname("SDL_QuitSubSystem");
extern fn uint wasInit(uint flags) @extname("SDL_WasInit");
extern fn void quit() @extname("SDL_Quit");
enum SDLWindowFlags : c_int
{
@@ -59,13 +59,13 @@ enum SDLWindowFlags : c_int
VULKAN = 0x10000000 /**< window usable for Vulkan surface */
}
extern func void* createWindow(char *title, uint x, uint y, int w, int h, uint flags) @extname("SDL_CreateWindow");
extern func void* getWindowSurface(void *window) @extname("SDL_GetWindowSurface");
extern fn void* createWindow(char *title, uint x, uint y, int w, int h, uint flags) @extname("SDL_CreateWindow");
extern fn void* getWindowSurface(void *window) @extname("SDL_GetWindowSurface");
const uint WINDOWPOS_UNDEFINED_MASK = 0x1FFF0000;
extern func int exit(int code);
extern func int printf(char *mess, ...);
extern fn int exit(int code);
extern fn int printf(char *mess, ...);
func bool initX()
fn bool initX()
{
//Initialization flag
bool success = true;
@@ -86,7 +86,7 @@ func bool initX()
}
func void close()
fn void close()
{
//Destroy window
// SDL_DestroyWindow( gWindow );
@@ -96,8 +96,8 @@ func void close()
quit();
}
extern func int pollEvent(SDL_Event *event) @extname("SDL_PollEvent");
extern func int updateWindowSurface(void *window) @extname("SDL_UpdateWindowSurface");
extern fn int pollEvent(SDL_Event *event) @extname("SDL_PollEvent");
extern fn int updateWindowSurface(void *window) @extname("SDL_UpdateWindowSurface");
enum SDLEventType : uint
{
@@ -223,7 +223,7 @@ union SDL_Event
const uint SDL_QUIT = 0x100;
func int main(int argc, char** args)
fn int main(int argc, char** args)
{
initX();
//Main loop flag

4
resources/testfragments/test.c3
View File

@@ -1,6 +1,6 @@
import std::io;
extern func int printf(char* message, ...);
extern fn int printf(char* message, ...);
macro void swap(&a, &b)
{
@@ -9,7 +9,7 @@ macro void swap(&a, &b)
b = temp;
}
func void main()
fn void main()
{
int x = 1;
int y = 2;

4
resources/testfragments/test_break.c3
View File

@@ -1,10 +1,10 @@
module foo;
extern func void printf(char *hello, ...);
extern fn void printf(char *hello, ...);
error MyError;
error YourError;
func void main()
fn void main()
{
int! i = 1;
catch (i)

26
resources/testfragments/testdefer.c3
View File

@@ -1,19 +1,19 @@
extern func void printf(char* message, ...);
extern fn void printf(char* message, ...);
public func void defer1() {}
public func void defer2() {}
public func void defer3() {}
public func void defer4() {}
public func void defer5() {}
public func void defer6() {}
public func void defer7() {}
public func void defer8() {}
public func void defer9() {}
public func void defer10() {}
public func void defer11() {}
public fn void defer1() {}
public fn void defer2() {}
public fn void defer3() {}
public fn void defer4() {}
public fn void defer5() {}
public fn void defer6() {}
public fn void defer7() {}
public fn void defer8() {}
public fn void defer9() {}
public fn void defer10() {}
public fn void defer11() {}
public func int main(int argc)
public fn int main(int argc)
{
int a = 0;
{

12
resources/testfragments/tmem.c3
View File

@@ -10,7 +10,7 @@ struct String
char* ptr;
}
func void String.init(String *s, char[] c)
fn void String.init(String *s, char[] c)
{
s.capacity = c.len + 16;
s.ptr = mem::_malloc(s.capacity);
@@ -18,7 +18,7 @@ func void String.init(String *s, char[] c)
mem::copy(s.ptr, (char*)(c), c.len);
}
func char* String.zstr(String *s)
fn char* String.zstr(String *s)
{
char* c = mem::_malloc(s.len + 1);
mem::copy(c, s.ptr, s.len);
@@ -26,7 +26,7 @@ func char* String.zstr(String *s)
return c;
}
func void String.appendc(String *s, char c)
fn void String.appendc(String *s, char c)
{
if (s.capacity == s.len)
{
@@ -38,7 +38,7 @@ func void String.appendc(String *s, char c)
s.ptr[s.len++] = c;
}
func void String.append(String *s, char[] other_string)
fn void String.append(String *s, char[] other_string)
{
if (s.capacity < s.len + other_string.len)
{
@@ -55,7 +55,7 @@ func void String.append(String *s, char[] other_string)
s.len += other_string.len;
}
func void String.concat(String *s, String* other_string)
fn void String.concat(String *s, String* other_string)
{
if (s.capacity < s.len + other_string.len)
{
@@ -72,7 +72,7 @@ func void String.concat(String *s, String* other_string)
s.len += other_string.len;
}
func void main()
fn void main()
{
String s;
s.init("Hello");

6
resources/testfragments/toposort.c3
View File

@@ -2,7 +2,7 @@ module topologicalsort;
import std::mem;
import std::array;
extern func void printf(char* x, ...);
extern fn void printf(char* x, ...);
struct InputPair
{
@@ -23,7 +23,7 @@ struct TopoList
}
func void sort(InputPair[] pairs, uint elements)
fn void sort(InputPair[] pairs, uint elements)
{
InputPair[] result = @array::make(InputPair, pairs.len);
TopoList* top = @array::make(TopoList, elements);
@@ -70,7 +70,7 @@ func void sort(InputPair[] pairs, uint elements)
}
}
func void main()
fn void main()
{
InputPair[10] pairs = {
{ 9, 2 },

2
resources/testproject/bar.c3
View File

@@ -3,7 +3,7 @@ module bar;
import baz::foo;
import testbaz::zab;
func void test()
fn void test()
{
Foo x;
baz::foo::test();

8
resources/testproject/foo.c3
View File

@@ -7,14 +7,14 @@ struct Foo
int a;
}
extern func void printf(char *hello);
extern fn void printf(char *hello);
private func void ofke()
private fn void ofke()
{}
private func void exple() {}
private fn void exple() {}
func void test()
fn void test()
{
printf("Hello from baz::foo::test()!\n");
}

4
resources/testproject/hello_world.c3
View File

@@ -1,9 +1,9 @@
module hello_world;
import bar;
extern func void printf(char *hello);
extern fn void printf(char *hello);
func int main(int x)
fn int main(int x)
{
printf("Hello World!\n");
bar::test();

1
src/compiler/compiler_internal.h
View File

@@ -365,6 +365,7 @@ typedef struct VarDecl_
bool unwrap : 1;
bool vararg : 1;
bool is_static : 1;
bool is_threadglobal : 1;
TypeInfo *type_info;
union
{

1
src/compiler/enums.h
View File

@@ -442,6 +442,7 @@ typedef enum
TOKEN_FN,
TOKEN_FUNC,
TOKEN_GENERIC,
TOKEN_GLOBAL,
TOKEN_IF,
TOKEN_IMPORT,
TOKEN_MACRO,

3
src/compiler/llvm_codegen.c
View File

@@ -363,6 +363,8 @@ void llvm_emit_global_variable_init(GenContext *c, Decl *decl)
// TODO fix name
LLVMValueRef old = decl->backend_ref;
decl->backend_ref = LLVMAddGlobal(c->module, LLVMTypeOf(init_value), decl->extname ? decl->extname : decl->external_name);
bool thread_local = !decl->var.is_threadglobal && decl->var.kind != VARDECL_CONST;
LLVMSetThreadLocal(decl->backend_ref, thread_local);
if (decl->section)
{
LLVMSetSection(decl->backend_ref, decl->section);
@@ -373,6 +375,7 @@ void llvm_emit_global_variable_init(GenContext *c, Decl *decl)
if (failable_ref)
{
llvm_set_alignment(failable_ref, type_alloca_alignment(type_anyerr));
LLVMSetThreadLocal(failable_ref, thread_local);
}
if (init_expr && IS_FAILABLE(init_expr) && init_expr->expr_kind == EXPR_FAILABLE)
{

23
src/compiler/parse_global.c
View File

@@ -73,16 +73,13 @@ void recover_top_level(Context *context)
switch (context->tok.type)
{
case TOKEN_PRIVATE:
case TOKEN_STRUCT:
case TOKEN_IMPORT:
case TOKEN_UNION:
case TOKEN_EXTERN:
case TOKEN_ENUM:
case TOKEN_GENERIC:
case TOKEN_ATTRIBUTE:
case TOKEN_DEFINE:
case TOKEN_ERRTYPE:
case TOKEN_BITSTRUCT:
return;
case TOKEN_IDENT: // Incr arrays only
case TOKEN_CONST:
@@ -95,6 +92,9 @@ void recover_top_level(Context *context)
case TOKEN_CT_SWITCH:
case TOKEN_FUNC:
case TOKEN_FN:
case TOKEN_STRUCT:
case TOKEN_UNION:
case TOKEN_BITSTRUCT:
case TYPELIKE_TOKENS:
// Only recover if this is in the first col.
if (TOKLOC(context->tok)->col == 1) return;
@@ -805,7 +805,8 @@ Decl *parse_decl(Context *context)
return parse_const_declaration(context, VISIBLE_LOCAL);
}
bool is_static = try_consume(context, TOKEN_STATIC);
bool is_threadglobal = try_consume(context, TOKEN_GLOBAL);
bool is_static = !is_threadglobal && try_consume(context, TOKEN_STATIC);
ASSIGN_TYPE_ELSE(TypeInfo *type, parse_failable_type(context), poisoned_decl);
@@ -815,7 +816,8 @@ Decl *parse_decl(Context *context)
SEMA_ERROR(decl, "You cannot use unwrap with a failable variable.");
return poisoned_decl;
}
decl->var.is_static = is_static;
decl->var.is_static = is_static || is_threadglobal;
decl->var.is_threadglobal = is_threadglobal;
return decl;
}
@@ -1009,9 +1011,9 @@ bool parse_attributes(Context *context, Attr ***attributes_ref)
/**
* global_declaration
* : failable_type IDENT ';'
* | failable_type IDENT '=' expression ';'
* | failable_type func_definition
* : global? failable_type IDENT ';'
* | global? failable_type IDENT '=' expression ';'
* | global? failable_type func_definition
* ;
*
* @param visibility
@@ -1019,10 +1021,14 @@ bool parse_attributes(Context *context, Attr ***attributes_ref)
*/
static inline Decl *parse_global_declaration(Context *context, Visibility visibility)
{
bool thread_global = try_consume(context, TOKEN_GLOBAL);
ASSIGN_TYPE_ELSE(TypeInfo *type, parse_failable_type(context), poisoned_decl);
Decl *decl = decl_new_var(context->tok.id, type, VARDECL_GLOBAL, visibility);
decl->var.is_threadglobal = thread_global;
if (TOKEN_IS(TOKEN_CONST_IDENT))
{
SEMA_TOKEN_ERROR(context->tok, "This looks like a constant variable, did you forget 'const'?");
@@ -2360,6 +2366,7 @@ Decl *parse_top_level_statement(Context *context)
case TOKEN_IMPORT:
SEMA_TOKEN_ERROR(context->tok, "Imports are only allowed directly after the module declaration.");
return poisoned_decl;
case TOKEN_GLOBAL:
case TYPELIKE_TOKENS:
{
ASSIGN_DECL_ELSE(decl, parse_global_declaration(context, visibility), poisoned_decl);

1
src/compiler/parse_stmt.c
View File

@@ -800,6 +800,7 @@ Ast *parse_stmt(Context *context)
return parse_decl_or_expr_stmt(context);
case TOKEN_VAR:
return parse_var_stmt(context);
case TOKEN_GLOBAL: // Global means declaration!
case TOKEN_STATIC: // Static means declaration!
case TOKEN_CONST: // Const means declaration!
return parse_declaration_stmt(context);

1
src/compiler/sema_expr.c
View File

@@ -1847,6 +1847,7 @@ static bool sema_analyse_body_expansion(Context *context, Expr *call)
assert(macro);
assert(macro->macro_decl.block_parameter.index);
// TODO handle named arguments
ExprCall *call_expr = &call->call_expr;
if (vec_size(call_expr->body_arguments))
{

2
src/compiler/tokens.c
View File

@@ -236,6 +236,8 @@ const char *token_type_to_string(TokenType type)
return "func";
case TOKEN_GENERIC:
return "generic";
case TOKEN_GLOBAL:
return "global";
case TOKEN_IF:
return "if";
case TOKEN_IMPORT:

4
test/test_suite/abi/literal_load.c3t
View File

@@ -7,9 +7,9 @@ struct Test
Test foo = {};
extern func void blorg(Test t);
extern fn void blorg(Test t);
func Test creator()
fn Test creator()
{
blorg(Test{});
return Test{};

4
test/test_suite/abi/literal_load_aarch64.c3t
View File

@@ -8,9 +8,9 @@ struct Test
Test foo = {};
extern func void blorg(Test t);
extern fn void blorg(Test t);
func Test creator()
fn Test creator()
{
blorg(Test{});
return Test{};

4
test/test_suite/abi/literal_load_mingw.c3t
View File

@@ -8,9 +8,9 @@ struct Test
Test foo = {};
extern func void blorg(Test t);
extern fn void blorg(Test t);
func Test creator()
fn Test creator()
{
blorg(Test{});
return Test{};

4
test/test_suite/abi/pass_large_aarch.c3t
View File

@@ -8,9 +8,9 @@ struct Large
void*[8] pointers;
}
extern func void pass_large(Large large);
extern fn void pass_large(Large large);
func void example()
fn void example()
{
Large l = {};
pass_large(l);

6
test/test_suite/abi/test_sret.c3t
View File

@@ -8,10 +8,10 @@ struct Abc {
long e;
}
extern func Abc foo1();
extern func Abc foo2();
extern fn Abc foo1();
extern fn Abc foo2();
func void bar() {
fn void bar() {
Abc dummy1 = foo1();
Abc dummy2 = foo2();
}

4
test/test_suite/abi/union_x64.c3t
View File

@@ -7,9 +7,9 @@ union Foo
long a;
char[12] b;
}
extern func void hello2(Foo f);
extern fn void hello2(Foo f);
func void hello(Foo f)
fn void hello(Foo f)
{
hello2(f);
}

12
test/test_suite/abi/vec2_aarch64.c3t
View File

@@ -5,12 +5,12 @@ struct Vector2 {
float x;
float y;
}
extern func Vector2 vector2_zero() { return Vector2 {}; }
extern func Vector2 vector2_one() { return Vector2 {}; }
extern func Vector2 vector2_add(Vector2 v1, Vector2 v2) { return Vector2 {}; }
extern func Vector2 vector2_add_value(Vector2 v, float add) { return Vector2 {}; }
extern func Vector2 vector2_subtract(Vector2 v1, Vector2 v2) { return Vector2 {}; }
extern func Vector2 vector2_subtract_value(Vector2 v, float sub) { return Vector2 {}; }
extern fn Vector2 vector2_zero() { return Vector2 {}; }
extern fn Vector2 vector2_one() { return Vector2 {}; }
extern fn Vector2 vector2_add(Vector2 v1, Vector2 v2) { return Vector2 {}; }
extern fn Vector2 vector2_add_value(Vector2 v, float add) { return Vector2 {}; }
extern fn Vector2 vector2_subtract(Vector2 v1, Vector2 v2) { return Vector2 {}; }
extern fn Vector2 vector2_subtract_value(Vector2 v, float sub) { return Vector2 {}; }
// #expect: abi.ll
%Vector2 = type { float, float }

12
test/test_suite/abi/vec2_x64.c3t
View File

@@ -5,12 +5,12 @@ struct Vector2 {
float x;
float y;
}
extern func Vector2 vector2_zero() { return Vector2 {}; }
extern func Vector2 vector2_one() { return Vector2 {}; }
extern func Vector2 vector2_add(Vector2 v1, Vector2 v2) { return Vector2 {}; }
extern func Vector2 vector2_add_value(Vector2 v, float add) { return Vector2 {}; }
extern func Vector2 vector2_subtract(Vector2 v1, Vector2 v2) { return Vector2 {}; }
extern func Vector2 vector2_subtract_value(Vector2 v, float sub) { return Vector2 {}; }
extern fn Vector2 vector2_zero() { return Vector2 {}; }
extern fn Vector2 vector2_one() { return Vector2 {}; }
extern fn Vector2 vector2_add(Vector2 v1, Vector2 v2) { return Vector2 {}; }
extern fn Vector2 vector2_add_value(Vector2 v, float add) { return Vector2 {}; }
extern fn Vector2 vector2_subtract(Vector2 v1, Vector2 v2) { return Vector2 {}; }
extern fn Vector2 vector2_subtract_value(Vector2 v, float sub) { return Vector2 {}; }
// #expect: abi.ll

2
test/test_suite/arrays/array_casts.c3t
View File

@@ -1,7 +1,7 @@
module array_casts;
func void test()
fn void test()
{
int[3] x;
int *y = &x;

4
test/test_suite/arrays/array_invalid_casts.c3
View File

@@ -1,11 +1,11 @@
func void test()
fn void test()
{
int[3] x;
double *y = &x; // #error: 'int[3]*' to 'double*
}
func void test2()
fn void test2()
{
int[3] x;
double[] z = &x; // #error: 'int[3]*' into 'double[]'

2
test/test_suite/arrays/array_literal.c3t
View File

@@ -1,7 +1,7 @@
// #target: x64-darwin
module array_literal;
func double test(uint x)
fn double test(uint x)
{
double[30] student_t = { 0.0 , 12.706 , 4.303 , 3.182 , 2.776 , 2.571 ,
2.447 , 2.365 , 2.306 , 2.262 , 2.228 ,

2
test/test_suite/arrays/array_struct.c3t
View File

@@ -6,7 +6,7 @@ struct Foo
int x, y;
}
private Foo[10] array;
private global Foo[10] array;
// #expect: test.ll

2
test/test_suite/arrays/complex_array_const.c3t
View File

@@ -8,7 +8,7 @@ struct Connection
long length;
}
private Connection[3] link
private global Connection[3] link
= { {1, "link1", 10},
{2, "link2", 20},
{3, "link3", 30} };

2
test/test_suite/arrays/global_array_non_const.c3
View File

@@ -8,7 +8,7 @@ int[B] c2; // #error: Expected an integer size.
int non_constant = 10;
int[non_constant] b; // #error: Expected a constant value as
func int foo()
fn int foo()
{
return 10;
}

2
test/test_suite/arrays/slice.c3
View File

@@ -1,4 +1,4 @@
func void test()
fn void test()
{
int[3] x = { 1, 2, 3 };
int[] z = &x;

4
test/test_suite/assert/assert_variants.c3t
View File

@@ -1,11 +1,11 @@
// #target: x64-windows
func int foo()
fn int foo()
{
return 1;
}
func void test()
fn void test()
{
int x = foo();
int y = foo();

8
test/test_suite/assert/local_static_assert_not_constant.c3
View File

@@ -1,19 +1,19 @@
int x = 3;
func void test()
fn void test()
{
$assert(x == 3); // #error: Compile time evaluation requires a compile time constant value.
}
func void test2()
fn void test2()
{
int i = 0;
$assert(1);
$assert(i == 0); // #error: Compile time evaluation requires a compile time constant value.
}
func int foo();
func void test3()
fn int foo();
fn void test3()
{
int i = 0;
$assert(foo() == 0); // #error: Compile time evaluation requires a compile time constant value.

2
test/test_suite/assert/static_assert.c3
View File

@@ -1,7 +1,7 @@
const int FOO = 2;
func void test()
fn void test()
{
$assert(FOO == 2, "Bad");
$assert(FOO == 0, "Good"); // #error: Compile time assert - Good

4
test/test_suite/assert/unreachable.c3t
View File

@@ -1,10 +1,10 @@
func int foo()
fn int foo()
{
return 1;
}
func void test()
fn void test()
{
int x = foo();
if (x > 0) return;

2
test/test_suite/assignment/int_assign.c3t
View File

@@ -1,6 +1,6 @@
module test;
func int foo()
fn int foo()
{
int x = 0;
int y;

2
test/test_suite/attributes/repeat_of_attributes.c3
View File

@@ -1,4 +1,4 @@
func void test()
fn void test()
{
for (int a @align(16) @align(16) = 0 ; a < 10; a++) // #error: Repeat of attribute 'align'
{

4
test/test_suite/cast/cast_ok.c3
View File

@@ -1,11 +1,11 @@
struct Foo { int a; }
func void test4()
fn void test4()
{
int x = (int)(32);
}
func void test5()
fn void test5()
{
Foo x = (Foo)(Foo{32});
}

4
test/test_suite/cast/cast_parse_fails.c3
View File

@@ -1,11 +1,11 @@
struct Foo { int a; }
func void test2()
fn void test2()
{
int x = int{ 32 }; // #error: 'int' cannot use compound literal initialization, did you intend to use a cast
}
func void test3()
fn void test3()
{
int x = int(32); // #error: A type cannot be followed by (), if you intended a cast, use (type)(expression)
}

2
test/test_suite/cast/cast_parse_fails2.c3
View File

@@ -1,7 +1,7 @@
struct Foo { int a; }
func void test1()
fn void test1()
{
Foo({ 32 });
(Foo)({ 32 }); // #error: Unexpected start of a block '{' here. If you intended a compound literal

2
test/test_suite/cast/cast_struct.c3
View File

@@ -22,7 +22,7 @@ struct BazTwo
int e;
}
func void test()
fn void test()
{
Foo x;
Bar y = (Bar)(x);

4
test/test_suite/cast/cast_struct_fails.c3
View File

@@ -22,12 +22,12 @@ struct BazTwo
int e;
}
func void test1()
fn void test1()
{
Foo x;
Bar z = (Baz)(x); // #error: cast 'Foo' to 'Baz'
}
func void test2()
fn void test2()
{
Baz x;
BazTwo z = (BazTwo)(x); // #error: cast 'Baz' to 'BazTwo'

2
test/test_suite/cast/cast_to_failable.c3
View File

@@ -3,7 +3,7 @@ errtype MyErr
FOO
}
func void test()
fn void test()
{
int! x;
int! d = ($typeof(MyErr.FOO!))(x); // #error: Casting to a failable type is not allowed

2
test/test_suite/comments/simple_comments.c3
View File

@@ -7,7 +7,7 @@ module comments;
Multiline span style
*/
func void test()
fn void test()
{
return;
}

12
test/test_suite/compile_time/compile_time_ptr_ref.c3t
View File

@@ -2,12 +2,12 @@
module test;
int*[] blurp = { &ptr, &ptr, (&ptr + 1), &ptr - 1, (int*)((iptr)(&ptr) - 4) };
int* c = (int*)((iptr)(&ptr) - 4);
int* c2 = (int*)((iptr)(&ptr) + 4);
int* c3 = (int*)(4 + (iptr)(&ptr));
iptr ff = (iptr)(&ptr);
int ptr = 0;
global int*[] blurp = { &ptr, &ptr, (&ptr + 1), &ptr - 1, (int*)((iptr)(&ptr) - 4) };
global int* c = (int*)((iptr)(&ptr) - 4);
global int* c2 = (int*)((iptr)(&ptr) + 4);
global int* c3 = (int*)(4 + (iptr)(&ptr));
global iptr ff = (iptr)(&ptr);
global int ptr = 0;
// #expect: test.ll

10
test/test_suite/compile_time/ct_if.c3t
View File

@@ -4,7 +4,7 @@ $else:
$elif (0):
$elif (0):
$else:
int x = 1;
global int x = 1;
$endif;
$endif;
@@ -18,7 +18,7 @@ $endif;
$if (1):
$assert(true);
int d = 5;
global int d = 5;
$elif (0):
$assert(false);
$else:
@@ -29,7 +29,7 @@ $if (0):
$assert(true);
$elif (1):
$assert(true);
int c = 5;
global int c = 5;
$else:
$assert(false);
$endif;
@@ -38,7 +38,7 @@ $if (0):
$assert(true);
$elif (1):
$assert(true);
int b = 4;
global int b = 4;
$elif (0):
$assert(false);
$else:
@@ -51,7 +51,7 @@ $elif (0):
$assert(false);
$elif (1):
$assert(true);
int a = 3;
global int a = 3;
$else:
$assert(false);
$endif;

Some files were not shown because too many files have changed in this diff Show More