Use "String" consistently for "char[]" (#694)

Use "String" consistently for "char[]". Fix win32 return value.

resources/examples/base64.c3

@@ -42,7 +42,7 @@ const char PAD = '=';
 const char FIRST = '+';
 const char LAST = 'z';
 
-fn void encode(char[] in, char *out)
+fn void encode(String in, char *out)
 {
 	int j = 0;
 	char c = LUT_ENC[1];
@@ -76,7 +76,7 @@ fn void encode(char[] in, char *out)
 }
 
 
-fn int! decode(char[] in, char* out, int* invalid_char_index = null)
+fn int! decode(String in, char* out, int* invalid_char_index = null)
 {
 	int j = 0;
 

resources/examples/binarydigits.c3

@@ -5,16 +5,16 @@ fn void main()
 {
     for (int i = 0; i < 20; i++)
     {
-        String s = bin(i);
+        VarString s = bin(i);
         defer s.destroy();
         io::printf("%s\n", s);
     }
 }
 
-fn String bin(int x)
+fn VarString bin(int x)
 {
     int bits = 1 + (int)(x == 0 ? 0 : math::log10((double)(x)) / math::log10(2));
-    String str;
+    VarString str;
     str.append_repeat('0', bits);
     for (int i = 0; i < bits; i++)
     {

resources/examples/brainfk.c3

@@ -10,13 +10,13 @@ fault InterpretError
 	INTEPRET_FAILED
 }
 
-fn void! print_error(usz pos, char[] err)
+fn void! print_error(usz pos, String err)
 {
 	io::printfln("Error at %s: %s", pos, err);
 	return InterpretError.INTEPRET_FAILED!;
 }
 
-fn void! brainf(char[] program)
+fn void! brainf(String program)
 {
 	usz sp = 0;
 	usz mem = 0;
@@ -76,7 +76,7 @@ fn void! brainf(char[] program)
 }
 fn void! main()
 {
-	char[] program = `
+	String program = `
 	++++[>+++++<-]>[<+++++>-]+<+[
         >[>+>+<<-]++>>[<<+>>-]>>>[-]++>[-]+
         >>>+[[-]++++++>>>]<<<[[<++++++++<++>>-]+<.<[>----<-]<]

resources/examples/contextfree/boolerr.c3

@@ -3,11 +3,11 @@ import libc;
 import std::io;
 
 struct Doc { Head *head; }
-struct Head { String* title; }
+struct Head { VarString* title; }
 
 struct Summary
 {
-	String* title;
+	VarString* title;
 	bool ok;
 }
 
@@ -21,11 +21,11 @@ private struct StringData
 
 fn void Summary.print(Summary *s, File out)
 {
-	char[] title = s.title ? s.title.str() : "missing";
+	String title = s.title ? s.title.str() : "missing";
 	out.printf("Summary({ .title = %s, .ok = %s})", title, s.ok);
 }
 
-fn bool contains(char[] haystack, char[] needle)
+fn bool contains(String haystack, String needle)
 {
 	usz len = haystack.len;
 	usz needle_len = needle.len;
@@ -54,13 +54,13 @@ fault ReadError
 	BAD_READ,
 }
 
-fn Doc! readDoc(char[] url)
+fn Doc! readDoc(String url)
 {
 	if (contains(url, "fail")) return ReadError.BAD_READ!;
 	if (contains(url, "head-missing")) return { .head = null };
 	if (contains(url, "title-missing")) return { @dupe(Head { .title = null }) };
-	if (contains(url, "title-empty")) return { @dupe(Head { .title = @dupe((String)null) }) };
-	String str;
+	if (contains(url, "title-empty")) return { @dupe(Head { .title = @dupe((VarString)null) }) };
+	VarString str;
 	str.printf("Title of %s", url);
 	return { @dupe(Head { .title = @dupe(str) }) };
 }
@@ -73,7 +73,7 @@ fn Summary buildSummary(Doc doc)
     };
 }
 
-fn Summary readAndBuildSummary(char[] url)
+fn Summary readAndBuildSummary(String url)
 {
 	return buildSummary(readDoc(url)) ?? Summary { .title = null, .ok = false };
 	/*
@@ -97,18 +97,18 @@ fault TitleResult
 fn bool! isTitleNonEmpty(Doc doc)
 {
 	if (!doc.head) return TitleResult.TITLE_MISSING!;
-	String* head = doc.head.title;
+	VarString* head = doc.head.title;
 	if (!head) return TitleResult.TITLE_MISSING!;
 	return head.len() > 0;
 }
 
 
-fn bool! readWhetherTitleNonEmpty(char[] url)
+fn bool! readWhetherTitleNonEmpty(String url)
 {
     return isTitleNonEmpty(readDoc(url));
 }
 
-fn char[] bool_to_string(bool b)
+fn String bool_to_string(bool b)
 {
 	return b ? "true" : "false";
 }
@@ -116,10 +116,10 @@ fn char[] bool_to_string(bool b)
 
 fn void main()
 {
-    const char[][] URLS = { "good", "title-empty", "title-missing", "head-missing", "fail" };
+    const String[] URLS = { "good", "title-empty", "title-missing", "head-missing", "fail" };
     DynamicArenaAllocator dynamic_arena;
 	dynamic_arena.init(1024);
-    foreach (char[] url : URLS)
+    foreach (String url : URLS)
     {
         mem::@scoped(&dynamic_arena)
         {
@@ -128,7 +128,7 @@ fn void main()
             io::printf("  Summary: ");
             summary.print(io::stdout());
             io::println("");
-            char[] title_sure = summary.title ? summary.title.str() : "";
+            String title_sure = summary.title ? summary.title.str() : "";
             io::printf("  Title: %s\n", title_sure);
             bool! has_title = readWhetherTitleNonEmpty(url);
             // This looks a bit less than elegant, but as you see it's mostly due to having to

resources/examples/contextfree/dynscope.c3

@@ -1,7 +1,7 @@
 module foo;
 import std::io;
 
-tlocal char[] context_user = "safe";
+tlocal String context_user = "safe";
 
 macro long reallyPerform(task)
 {
@@ -14,7 +14,7 @@ macro long perform(task)
 	return reallyPerform(task);
 }
 
-macro @with_mode(char[] user, #action, ...)
+macro @with_mode(String user, #action, ...)
 {
 	@scope(context_user)
 	{
@@ -27,6 +27,6 @@ fn void main()
 {
 	long val1 = perform("something");
 	long val2 = @with_mode("faster", perform, "reliable");
-	long val3 = perform(char[][] {"something"});
+	long val3 = perform(String[] {"something"});
 	io::printfln("%d %d %d", val1, val2, val3);
 }

resources/examples/contextfree/guess_number.c3

@@ -23,14 +23,14 @@ int err_count = 0;
 fn int! askGuess(int high)
 {
 	libc::printf("Guess a number between 1 and %d: ", high);
-	char[] text = readLine()?;
+	String text = readLine()?;
 	char* end = null;
 	int value = (int)libc::strtol(text.ptr, &end, 10);
 	if (end && end[0] >= ' ') return InputResult.NOT_AN_INT!;
 	return value;
 }
 
-fn char[]! readLine()
+fn String! readLine()
 {
 	char* chars = tmalloc(1024)?;
 	isz loaded = getline(&chars, &&(usz)1023, libc::stdin());
@@ -67,7 +67,7 @@ fn void! Game.play(Game *game)
 
 fn void Game.report(Game *game, int guess)
 {
-	char[] desc = {|
+	String desc = {|
 		if (guess < game.answer) return "too low";
 		if (guess > game.answer) return "too high";
 		return "the answer";

resources/examples/contextfree/multi.c3

@@ -9,7 +9,7 @@ fn void main()
     	    And a nested comment.
     	*/
     */
-	char[] text = `
+	String text = `
  		function hello() {
  		  console.log("name`"\t"`age");
  		}

resources/examples/fasta.c3

@@ -15,7 +15,7 @@ fn float fasta_rand(float max_val)
 	return max_val * seed / IM;
 }
 
-private char[] alu =
+private String alu =
 	"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"
 	"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"
 	"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"
@@ -25,7 +25,7 @@ private char[] alu =
 	"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
 
 
-char[] iub = "acgtBDHKMNRSVWY";
+String iub = "acgtBDHKMNRSVWY";
 double[] iub_p = {
 	0.27,
 	0.12,
@@ -43,7 +43,7 @@ double[] iub_p = {
 	0.02,
 	0.02 };
 
-char[] homosapiens = "acgt";
+String homosapiens = "acgt";
 double[] homosapiens_p = {
 	0.3029549426680,
 	0.1979883004921,
@@ -54,7 +54,7 @@ double[] homosapiens_p = {
 const LINELEN = 60;
 
 // slowest character-at-a-time output
-fn void repeat_fasta(char[] seq, int n)
+fn void repeat_fasta(String seq, int n)
 {
 	usz len = seq.len;
 	int i = void;
@@ -66,7 +66,7 @@ fn void repeat_fasta(char[] seq, int n)
 	if (i % LINELEN != 0) io::putchar('\n');
 }
 
-fn void random_fasta(char[] symb, double[] probability, int n)
+fn void random_fasta(String symb, double[] probability, int n)
 {
 	assert(symb.len == probability.len);
 	int len = probability.len;

resources/examples/hash.c3

@@ -7,7 +7,7 @@ import libc;
 
 fn void main()
 {
-    char[] y = "Hello World!";
+    String y = "Hello World!";
     libc::printf("Adler32 of %s is %x, expected 1c49043e\n", (char*)(y), adler32(y));
     libc::printf("CRC32B of %s is %x, expected 1c291ca3\n", (char*)(y), crc32(y));
     libc::printf("CRC64 of %s is %llx, expected fad9a77c67077205\n", (char*)(y), crc64(y));

resources/examples/hello_world_many.c3

@@ -2,7 +2,7 @@ import std::io;
 
 fn void main()
 {
-    char[][] greetings = {
+    String[] greetings = {
         "Hello, world!",
         "¡Hola Mundo!",
         "Γειά σου Κόσμε!",

resources/examples/levenshtein.c3

@@ -2,7 +2,7 @@ module levenshtein;
 import std::math;
 
 // This levenshtein exercises C3 subarrays.
-fn int levenshtein(char[] s, char[] t)
+fn int levenshtein(String s, String t)
 {
 	// if either string is empty, difference is inserting all chars
 	// from the other

resources/examples/nbodies.c3

@@ -142,7 +142,7 @@ fn void scale_bodies(Planet[] bodies, double scale)
 }
 
 
-fn void main(char[][] args)
+fn void main(String[] args)
 {
 	int n = args.len < 2 ? 50000000 : str::to_int(args[1])!!;
 

resources/examples/notworking/madlibs.c3

@@ -4,10 +4,10 @@ import regex, stdio;
 fn void main()
 {
     println("Enter a story template, terminated by an empty line:");
-    String story = "";
+    VarString story = "";
     while (1)
     {
-        String line = stdin.readln().strip() else break;
+        VarString line = stdin.readln().strip() else break;
         story = story.append(line);
         story = story.append("\n");
     }
@@ -19,7 +19,7 @@ fn void main()
 
     foreach (RegexMatch* match : r.match(story))
     {
-        String s = match.string;
+        VarString s = match.string;
         printf("Enter a value for '%s': ", s[1..^2]);
         string word = stdin.readln().strip() else return;
         story = story.replace(s, word);

resources/examples/notworking/toml_tokenizer_c2.c3

@@ -7,7 +7,7 @@ import stdlib;
 
 const uint MaxText = 1024;
 
-enum TokenKind : char (String name)
+enum TokenKind : char (VarString name)
 {
     WORD("word"),
     TEXT("text"),

resources/examples/plus_minus.c3

@@ -10,15 +10,15 @@ fault TokenResult
 
 // While we could have written this with libc
 // the C way, let's showcase some features added to C3.
-fn void main(char[][] args)
+fn void main(String[] args)
 {
 	// Grab a string from stdin
-	String s = io::stdin().getline();
+	VarString s = io::stdin().getline();
 	// Delete it at scope end [defer]
 	defer s.destroy();
 
 	// Grab the string as a slice.
-	char[] numbers = s.str();
+	String numbers = s.str();
 
 	// Track our current value
 	int val = 0;
@@ -26,7 +26,7 @@ fn void main(char[][] args)
 	// Is the current state an add?
 	bool add = true;
 
-	while (try char[] token = read_next(&numbers))
+	while (try String token = read_next(&numbers))
 	{
 		// We're assuming well formed input here
 		// so just use atoi.
@@ -36,7 +36,7 @@ fn void main(char[][] args)
 		val = add ? val + i : val - i;
 
 		// Read an optional token.
-		char[]! op = read_next(&numbers);
+		String! op = read_next(&numbers);
 
 		// If it's an error, then we're done.
 		if (catch op) break;
@@ -56,7 +56,7 @@ fn void main(char[][] args)
 	io::printfln("%d", val);
 }
 
-fn char[]! read_next(char[]* remaining)
+fn String! read_next(String* remaining)
 {
 	while (remaining.len > 0 && (*remaining)[0] == ' ')
 	{

resources/examples/spectralnorm.c3

@@ -42,7 +42,7 @@ fn void eval_AtA_times_u(double[] u, double[] atau, double[] x)
 	eval_At_times_u(temparr, atau, x);
 }
 
-fn void main(char[][] args)
+fn void main(String[] args)
 {
 	int n = args.len == 2 ? str::to_int(args[1])!! : 2000;
 	temparr = array::alloc(double, n);

resources/testfragments/allocators_testing.c3

@@ -12,7 +12,7 @@ fn void print_pages()
 	mem::temp_allocator().print_pages(io::stdout());
 }
 
-fn void setstring(char* dst, char[] str)
+fn void setstring(char* dst, String str)
 {
 	foreach (char c : str)
 	{

resources/testfragments/parsertest.c3

@@ -143,7 +143,7 @@ $else
 
 generic boofer2(i, g, eok)
 {
-    case int, char[], type($eoo):
+    case int, String, type($eoo):
         return "Helo";
     default:
         return 1000;

resources/testfragments/tmem.c3

@@ -2,7 +2,7 @@ module tmem;
 import std::mem;
 import std::io;
 
-struct String
+struct VarString
 {
     Allocator allocator;
     usz len;
@@ -10,7 +10,7 @@ struct String
     char* ptr;
 }
 
-fn void String.init(String *s, char[] c)
+fn void VarString.init(VarString *s, String c)
 {
     s.capacity = c.len + 16;
     s.ptr = malloc(s.capacity);
@@ -18,7 +18,7 @@ fn void String.init(String *s, char[] c)
     mem::copy(s.ptr, (char*)(c), c.len);
 }
 
-fn char* String.zstr(String *s)
+fn char* VarString.zstr(VarString *s)
 {
     char* c = malloc(s.len + 1);
     mem::copy(c, s.ptr, s.len);
@@ -26,7 +26,7 @@ fn char* String.zstr(String *s)
     return c;
 }
 
-fn void String.appendc(String *s, char c)
+fn void VarString.appendc(VarString *s, char c)
 {
     if (s.capacity == s.len)
     {
@@ -38,7 +38,7 @@ fn void String.appendc(String *s, char c)
     s.ptr[s.len++] = c;
 }
 
-fn void String.append(String *s, char[] other_string)
+fn void VarString.append(VarString *s, String other_string)
 {
     if (s.capacity < s.len + other_string.len)
     {
@@ -55,7 +55,7 @@ fn void String.append(String *s, char[] other_string)
     s.len += other_string.len;
 }
 
-fn void String.concat(String *s, String* other_string)
+fn void VarString.concat(VarString *s, VarString* other_string)
 {
     if (s.capacity < s.len + other_string.len)
     {
@@ -74,12 +74,12 @@ fn void String.concat(String *s, String* other_string)
 
 fn void main()
 {
-    String s;
+    VarString s;
     s.init("Hello");
     s.appendc(' ');
     s.appendc('W');
     s.append("orld!");
-    String w;
+    VarString w;
     w.init("Yo man!");
     s.concat(&w);
     libc::printf("Message was: %s\n", s.zstr());

resources/testproject/project.json

@@ -27,7 +27,6 @@
     "hello_world_win32": {
       "type": "executable",
       "c-sources-override": [
-        "./csource/**"
       ]
     },
     "hello_world_lib": {