Rollback global.

resources/examples/fasta.c3

@@ -6,7 +6,7 @@ const IA = 3877;
 const IC = 29573;
 const SEED = 42;
 
-global uint seed = SEED;
+uint seed = SEED;
 
 fn float fasta_rand(float max)
 {
@@ -14,7 +14,7 @@ fn float fasta_rand(float max)
 	return max * seed / IM;
 }
 
-private global char[] alu =
+private char[] alu =
   "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"
   "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"
   "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"
@@ -24,8 +24,8 @@ private global char[] alu =
   "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
 
 
-global char[] iub = "acgtBDHKMNRSVWY";
-global double[] iub_p = {
+char[] iub = "acgtBDHKMNRSVWY";
+double[] iub_p = {
   0.27,
   0.12,
   0.12,
@@ -42,8 +42,8 @@ global double[] iub_p = {
   0.02,
   0.02 };
 
-global char[] homosapiens = "acgt";
-global double[] homosapiens_p = {
+char[] homosapiens = "acgt";
+double[] homosapiens_p = {
   0.3029549426680,
   0.1979883004921,
   0.1975473066391,

resources/examples/notworking/acornvm/avm_stack.c3

@@ -388,11 +388,11 @@ fn void Value.setTop(Value* th as AintIdx idx)
 }
 
 /* ****************************************
-   GLOBAL VARIABLE ACCESS
+   VARIABLE ACCESS
    ***************************************/
 
 /**
- * Push and return the symbolically-named global variable's value
+ * Push and return the symbolically-named variable's value
  * @require vm(*th).global.isTbl()
  **/
 fn Value Value.pushGloVar(Value* th, string var)
@@ -405,7 +405,7 @@ fn Value Value.pushGloVar(Value* th, string var)
 }
 
 /**
- * Alter the symbolically-named global variable to have the value popped off the local stack
+ * Alter the symbolically-named variable to have the value popped off the local stack
  * @require stkSz(th) > 0, vm(th).global.isTbl()
  **/
 fn void Value.popGloVar(Value* th, string var)
@@ -417,7 +417,7 @@ fn void Value.popGloVar(Value* th, string var)
 	th(*th).stk_top -= 2; // Pop key & value after value is safely in Global
 }
 
-/* Push the value of the current process thread's global variable table. */
+/* Push the value of the current process thread's variable table. */
 Value pushGlobal(Value th)
 {
 	stkCanIncTop(th); /* Check if there is room */

resources/examples/notworking/acornvm/gen.c3

@@ -381,7 +381,7 @@ void genAssign(CompInfo *comp, Value lval, Value rval) {
 	if (opcode)
 		genDoProp(comp, lval, opcode, rval, 1);
 	else {
-		// Handle parallel, local, closure, global variable assignments where rval is loaded first
+		// Handle parallel, local, closure, variable assignments where rval is loaded first
 		int nlvals = lvalop==vmlit(SymComma)? arr_size(lval)-1 : 1;
 		bool varrvals = false;
 		AuintIdx rvalreg;
@@ -445,7 +445,7 @@ void genAssign(CompInfo *comp, Value lval, Value rval) {
 				genAddInstr(comp, BCINS_ABC(OpLoadReg, localreg, rvalreg, 0));
 			else if ((localreg = findClosureVar(comp, symnm))!=-1)
 				genAddInstr(comp, BCINS_ABC(OpSetClosure, localreg, rvalreg, 0));
-		// Load into a global variable
+		// Load into a variable
 		} else if (vmlit(SymGlobal) == lvalop)
 			genAddInstr(comp, BCINS_ABx(OpSetGlobal, rvalreg, genAddLit(comp, astGet(th, lval, 1))));
 	}

resources/examples/notworking/acornvm/parser.c3

@@ -143,7 +143,7 @@ void parseValue(CompInfo* comp, Value astseg)
 		astAddSeg2(th, astseg, vmlit(SYM_EXT), anInt(genAddUrlLit(comp, comp->lex->token)));
 		lexGetNextToken(comp->lex);
 	}
-	// Local or global variable / name token
+	// Local or variable / name token
 	else if (comp->lex->toktype == Name_Token) {
 		Value symnm = pushValue(th, comp->lex->token);
 		lexGetNextToken(comp->lex);
@@ -240,7 +240,7 @@ void parseValue(CompInfo* comp, Value astseg)
 					Value symnm = comp->lex->token;
 					const char first = (toStr(symnm))[0];
 					if (first=='$' || (first>='A' && first<='Z'))
-						lexLog(comp->lex, "A global name may not be a closure variable");
+						lexLog(comp->lex, "A name may not be a closure variable");
 					arrAdd(th, comp->clovarseg, symnm);
 					lexGetNextToken(comp->lex);
 
@@ -985,7 +985,7 @@ void parseProgram(CompInfo* comp) {
 				Value symnm = comp->lex->token;
 				const char first = (toStr(symnm))[0];
 				if (first=='$' || (first>='A' && first<='Z'))
-					lexLog(comp->lex, "A global name may not be a method parameter");
+					lexLog(comp->lex, "A name may not be a method parameter");
 				else {
 					if (findLocalVar(comp, symnm)==-1) {
 						arrAdd(th, comp->locvarseg, symnm);

resources/examples/notworking/acornvm/vm.c3

@@ -13,7 +13,7 @@ void core_init(Value th); // Initialize all core types
  *   different encoding types.
  * - The symbol table, which is shared across everywhere
  * - The main thread, which is the recursive root for garbage collection.
- *   The thread manages the global namespace, including all registered
+ *   The thread manages the namespace, including all registered
  *   core types (including the Acorn compiler and resource types).
  *
  * See newVm() for more detailed information on VM initialization.
@@ -34,12 +34,12 @@ struct VmInfo
 	ulong pcgrng_state;		    //!< PCG random-number generator state
 	ulong pcgrng_inc;	    	//!< PCG random-number generator inc value
 
-	Value global;				//!< VM's "built in" Global hash table
+	Value global;				//!< VM's "built in" hash table
 
 	Value main_thread;			//!< VM's main thread
 	ThreadInfo main_thr;        //!< State space for main thread
 
-	SymTable sym_table;	        //!< global symbol table
+	SymTable sym_table;	        //!< symbol table
 	AuintIdx hashseed;			//!< randomized seed for hashing strings
 	Value literals;				//!< array of all built-in symbol and type literals
 	Value stdidx;				//!< Table to convert std symbol to index
@@ -252,7 +252,7 @@ macro memcpy_Auint(i, val)
  *   and which to discard.
  * - All value encodings are initialized next, including the single symbol table
  *   used across the VM.
- * - The main thread is started up, initializing its global namespace.
+ * - The main thread is started up, initializing its namespace.
  * - All core types are progressively loaded, establishing the default types for
  *   each encoding. This includes the resource types and Acorn compiler. */
 fn Value new(void)
@@ -290,13 +290,13 @@ fn Value new(void)
 	memcpy_Auint(3, &newVM)		// public function
 	vm->hashseed = tblCalcStrHash(seedstr, sizeof(seedstr), (AuintIdx) timehash);
 
-	// Initialize vm-wide symbol table, global table and literals
+	// Initialize vm-wide symbol table, table and literals
 	sym_init(th); // Initialize hash table for symbols
-	newTbl(th, &vm->global, aNull, GLOBAL_NEWSIZE); // Create global hash table
+	newTbl(th, &vm->global, aNull, GLOBAL_NEWSIZE); // Create hash table
 	mem_markChk(th, vm, vm->global);
 	vm_litinit(th); // Load reserved and standard symbols into literal list
-	core_init(th); // Load up global table and literal list with core types
-	setType(th, vm->global, vmlit(TypeIndexm)); // Fix up type info for global table
+	core_init(th); // Load up table and literal list with core types
+	setType(th, vm->global, vmlit(TypeIndexm)); // Fix up type info for table
 
 	// Initialize byte-code standard methods and the Acorn compiler
 	vm_stdinit(th);

resources/testfragments/lexertest.c3

@@ -1,6 +1,6 @@
 module foo;
 
-const int GLOBAL = 0;
+const int = 0;
 
 struct Boo
 {